EMAIL THIS PAGE TO A FRIEND

C2orf90

chromosome 2 open reading frame 90

20 Gene Product Result for
Species: Human C2orf90(391343)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013662 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013662 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013662 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013662 Rosetta Predictions human pricing
XM_926263 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306436 predicted 655
2 SASI_Hs02_00306437 predicted 704
3 SASI_Hs02_00306438 predicted 883
4 SASI_Hs02_00306439 predicted 969
5 SASI_Hs02_00306440 predicted 886
6 SASI_Hs02_00306441 predicted 811
7 SASI_Hs02_00306442 predicted 863
8 SASI_Hs02_00306443 predicted 919
9 SASI_Hs02_00306444 predicted 851
10 SASI_Hs02_00306445 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252608 predicted 280
2 SASI_Hs01_00252609 predicted 758
3 SASI_Hs01_00252610 predicted 362
4 SASI_Hs01_00252611 predicted 224
5 SASI_Hs01_00252612 predicted 303
6 SASI_Hs01_00252613 predicted 298
7 SASI_Hs01_00252614 predicted 991
8 SASI_Hs01_00252615 predicted 43
9 SASI_Hs01_00252616 predicted 53
10 SASI_Hs01_00252617 predicted 131
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013662
C2orf90 MISSION shRNA Bacterial Glycerol Stock
chromosome 2 open reading frame 90
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000284489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013662.2-639s21c1
Sequence:CCGGAGGAGGCTGGGAGGAAATGAACTCGAGTTCATTTCCTCCCAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013662.2-914s21c1
Sequence:CCGGACGTAGGTACGTTGATCATATCTCGAGATATGATCAACGTACCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013662.2-700s21c1
Sequence:CCGGCTGGTGTCTGGTTAGTCTTTACTCGAGTAAAGACTAACCAGACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013662.2-669s21c1
Sequence:CCGGTTGTGAAATTTCTGGATTTGGCTCGAGCCAAATCCAGAAATTTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013662
C2orf90 MISSION shRNA shRNA Plasmid DNA
chromosome 2 open reading frame 90
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000284489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013662.2-639s21c1
Sequence:CCGGAGGAGGCTGGGAGGAAATGAACTCGAGTTCATTTCCTCCCAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013662.2-914s21c1
Sequence:CCGGACGTAGGTACGTTGATCATATCTCGAGATATGATCAACGTACCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013662.2-700s21c1
Sequence:CCGGCTGGTGTCTGGTTAGTCTTTACTCGAGTAAAGACTAACCAGACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013662.2-669s21c1
Sequence:CCGGTTGTGAAATTTCTGGATTTGGCTCGAGCCAAATCCAGAAATTTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013662
C2orf90 MISSION shRNA Lentiviral Transduction Particles
chromosome 2 open reading frame 90
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000284489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013662.2-639s21c1
Sequence:CCGGAGGAGGCTGGGAGGAAATGAACTCGAGTTCATTTCCTCCCAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013662.2-914s21c1
Sequence:CCGGACGTAGGTACGTTGATCATATCTCGAGATATGATCAACGTACCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013662.2-700s21c1
Sequence:CCGGCTGGTGTCTGGTTAGTCTTTACTCGAGTAAAGACTAACCAGACACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013662.2-669s21c1
Sequence:CCGGTTGTGAAATTTCTGGATTTGGCTCGAGCCAAATCCAGAAATTTCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks