EMAIL THIS PAGE TO A FRIEND

C3

complement component 3

62 Gene Product Result for
Synonyms: AHUS5 ARMD9 ASP C3a C3b CPAMD1
UniProtKB ID: P01024, A7E236
Gene ID:
Human(718) Summary: Complement component C3 plays a central role in the activation of complement system. Its activation is required for both classical and alternative complement activation pathways. People with C3 deficiency are susceptible to bacterial infection. [provided by RefSeq, Feb 2009]
Mouse(12266) complement component 3
Rat(24232) complement component 3
chicken(396370) complement component 3
dog(476728) complement component 3
cow(280677) complement component 3
sheep(443475) complement component 3
Domestic Rabbit(100009121) complement component 3
naked mole-rat(101726247) complement component 3
domestic guinea pig(100135462) complement component 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000064 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
AB3421 Anti-Complement C3 Antibody Detect Complement C3 using this Anti-Complement C3 Antibody validated for use in ELISA. pricing
CBL191 Anti-Complement C3a Antibody, clone H13 This Anti-Complement C3a Antibody, clone H13 is validated for use in ELISA, IH, WB for the detection of Complement C3a. pricing
MABF1978 Anti-Complement C3a/C3a (desArg) Antibody, clone K13/16 Anti-Complement C3a/C3a (desArg), clone K13/16, Cat. No. MABF1978, is a mouse monoclonal antibody that detects Complement C3a and has been tested for use in Flow Cytometry, Immunohistochemistry (Paraffin), Neutralization, and Agonist and Inhibition studies. pricing
MABF972 Anti-Complement C3b/iC3b Antibody, clone 3E7, neutralizing This mouse monoclonal Anti-Complement C3b/iC3b Antibody, clone 3E7, Cat. No. MABF972 is a neutralizing antibody validated for use in Flow Cytometry, for the detection of C3b. pricing
MABF961 Anti-Complement C3b/iC3b Antibody, clone 5G9, neutralizing This mouse monoclonal Anti-Complement C3b/iC3b Antibody, clone 5G9, Cat. No. MABF961 is a neutralizing antibody validated for use in Flow Cytometry, for the detection of C3b. pricing
MABF982 Anti-Complement C3b/iC3b Antibody, clone 6C9 This mouse monoclonal Anti-Complement C3b/iC3b Antibody, clone 6C9, Cat. No. MABF982 is validated for use in Flow Cytometry, for the detection of C3b. pricing
MABF983 Anti-Complement C3b/iC3b/C3dg Antibody, clone 1H8 This mouse monoclonal Anti-Complement C3b/iC3b/C3dg Antibody, clone 1H8, Cat. No. MABF983 is validated for use in Flow Cytometry, for the detection of C3b. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000064 Rosetta Predictions human pricing
NM_016994 Rosetta Predictions rat pricing
NM_009778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157921 predicted 365
2 SASI_Hs02_00301781 predicted 3729
3 SASI_Hs01_00157922 predicted 3590
4 SASI_Hs01_00157923 predicted 4722
5 SASI_Hs01_00157924 predicted 749
6 SASI_Hs01_00157925 predicted 3324
7 SASI_Hs02_00301782 predicted 209
8 SASI_Hs01_00157928 predicted 3438
9 SASI_Hs01_00157929 predicted 220
10 SASI_Hs02_00301783 predicted 3881
11 SASI_Hs01_00157926 predicted 1422
12 SASI_Hs01_00157927 predicted 4466
13 SASI_Hs01_00157930 predicted 2338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111339 predicted 1879
2 SASI_Rn01_00111340 predicted 1368
3 SASI_Rn01_00111341 predicted 2682
4 SASI_Rn01_00111342 predicted 3114
5 SASI_Rn02_00261133 predicted 4184
6 SASI_Rn02_00261134 predicted 4788
7 SASI_Rn01_00111345 predicted 1392
8 SASI_Rn01_00111346 predicted 2399
9 SASI_Rn01_00111347 predicted 3339
10 SASI_Rn01_00111348 predicted 2804
11 SASI_Rn01_00111343 predicted 2139
12 SASI_Rn01_00111344 predicted 4189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163595 predicted 1930
2 SASI_Mm01_00163597 predicted 4536
3 SASI_Mm02_00317005 predicted 3906
4 SASI_Mm01_00163598 predicted 3399
5 SASI_Mm01_00163599 predicted 3948
6 SASI_Mm01_00163600 predicted 3705
7 SASI_Mm01_00163601 predicted 2135
8 SASI_Mm01_00163602 predicted 4700
9 SASI_Mm01_00163603 predicted 2453
10 SASI_Mm02_00317006 predicted 2661
11 SASI_Mm01_00163596 predicted 3581
12 SASI_Mm01_00163604 predicted 2618
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000064
VALIDATED
C3 MISSION shRNA Bacterial Glycerol Stock
complement component 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000064.2-748s21c1
Sequence:CCGGTGCCCAGTTTCGAGGTCATAGCTCGAGCTATGACCTCGAAACTGGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000064.2-2311s21c1
Sequence:CCGGACCTGGATGAGGACATCATTGCTCGAGCAATGATGTCCTCATCCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000064.2-544s21c1
Sequence:CCGGGGACGGTCATGGTCAACATTGCTCGAGCAATGTTGACCATGACCGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000064.1-3425s1c1
Sequence:CCGGCGCCCGTGATACACCAAGAAACTCGAGTTTCTTGGTGTATCACGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000064.1-1869s1c1
Sequence:CCGGCGTGCTGAATAAGAAGAACAACTCGAGTTGTTCTTCTTATTCAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000064.1-4377s1c1
Sequence:CCGGCGATAGGAACACCCTCATCATCTCGAGATGATGAGGGTGTTCCTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000064.1-2856s1c1
Sequence:CCGGGCCGGAAGGAATCAGAATGAACTCGAGTTCATTCTGATTCCTTCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000064.1-4501s1c1
Sequence:CCGGGCCTATTACAACCTGGAGGAACTCGAGTTCCTCCAGGTTGTAATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000064
VALIDATED
C3 MISSION shRNA shRNA Plasmid DNA
complement component 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000064.2-748s21c1
Sequence:CCGGTGCCCAGTTTCGAGGTCATAGCTCGAGCTATGACCTCGAAACTGGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000064.2-2311s21c1
Sequence:CCGGACCTGGATGAGGACATCATTGCTCGAGCAATGATGTCCTCATCCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000064.2-544s21c1
Sequence:CCGGGGACGGTCATGGTCAACATTGCTCGAGCAATGTTGACCATGACCGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000064.1-3425s1c1
Sequence:CCGGCGCCCGTGATACACCAAGAAACTCGAGTTTCTTGGTGTATCACGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000064.1-1869s1c1
Sequence:CCGGCGTGCTGAATAAGAAGAACAACTCGAGTTGTTCTTCTTATTCAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000064.1-4377s1c1
Sequence:CCGGCGATAGGAACACCCTCATCATCTCGAGATGATGAGGGTGTTCCTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000064.1-2856s1c1
Sequence:CCGGGCCGGAAGGAATCAGAATGAACTCGAGTTCATTCTGATTCCTTCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000064.1-4501s1c1
Sequence:CCGGGCCTATTACAACCTGGAGGAACTCGAGTTCCTCCAGGTTGTAATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000064
VALIDATED
C3 MISSION shRNA Lentiviral Transduction Particles
complement component 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000064.2-748s21c1
Sequence:CCGGTGCCCAGTTTCGAGGTCATAGCTCGAGCTATGACCTCGAAACTGGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000064.2-2311s21c1
Sequence:CCGGACCTGGATGAGGACATCATTGCTCGAGCAATGATGTCCTCATCCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000064.2-544s21c1
Sequence:CCGGGGACGGTCATGGTCAACATTGCTCGAGCAATGTTGACCATGACCGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000064.1-3425s1c1
Sequence:CCGGCGCCCGTGATACACCAAGAAACTCGAGTTTCTTGGTGTATCACGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000064.1-1869s1c1
Sequence:CCGGCGTGCTGAATAAGAAGAACAACTCGAGTTGTTCTTCTTATTCAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000064.1-4377s1c1
Sequence:CCGGCGATAGGAACACCCTCATCATCTCGAGATGATGAGGGTGTTCCTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000064.1-2856s1c1
Sequence:CCGGGCCGGAAGGAATCAGAATGAACTCGAGTTCATTCTGATTCCTTCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000064.1-4501s1c1
Sequence:CCGGGCCTATTACAACCTGGAGGAACTCGAGTTCCTCCAGGTTGTAATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009778
VALIDATED
C3 MISSION shRNA Bacterial Glycerol Stock
complement component 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009778.2-762s21c1
Sequence:CCGGGCAGAGTTTGAGGTGAAGGAACTCGAGTTCCTTCACCTCAAACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009778.2-364s21c1
Sequence:CCGGCCATCAAGATTCCAGCCAGTACTCGAGTACTGGCTGGAATCTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009778.2-1668s21c1
Sequence:CCGGCCAGAGTTTATTCCTTCATTTCTCGAGAAATGAAGGAATAAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009778.2-901s21c1
Sequence:CCGGACGGGACAGCCTTCGTGATTTCTCGAGAAATCACGAAGGCTGTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009778.1-319s1c1
Sequence:CCGGCCATCAAGATTCCAGCCAGTACTCGAGTACTGGCTGGAATCTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009778.1-3422s1c1
Sequence:CCGGGCCCGTGATTCACCAAGAAATCTCGAGATTTCTTGGTGAATCACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009778.1-3863s1c1
Sequence:CCGGCCAGGCTACCTTCATGGTATTCTCGAGAATACCATGAAGGTAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009778.1-1623s1c1
Sequence:CCGGCCAGAGTTTATTCCTTCATTTCTCGAGAAATGAAGGAATAAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009778.1-717s1c1
Sequence:CCGGGCAGAGTTTGAGGTGAAGGAACTCGAGTTCCTTCACCTCAAACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009778
VALIDATED
C3 MISSION shRNA shRNA Plasmid DNA
complement component 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009778.2-762s21c1
Sequence:CCGGGCAGAGTTTGAGGTGAAGGAACTCGAGTTCCTTCACCTCAAACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009778.2-364s21c1
Sequence:CCGGCCATCAAGATTCCAGCCAGTACTCGAGTACTGGCTGGAATCTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009778.2-1668s21c1
Sequence:CCGGCCAGAGTTTATTCCTTCATTTCTCGAGAAATGAAGGAATAAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009778.2-901s21c1
Sequence:CCGGACGGGACAGCCTTCGTGATTTCTCGAGAAATCACGAAGGCTGTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009778.1-319s1c1
Sequence:CCGGCCATCAAGATTCCAGCCAGTACTCGAGTACTGGCTGGAATCTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009778.1-3422s1c1
Sequence:CCGGGCCCGTGATTCACCAAGAAATCTCGAGATTTCTTGGTGAATCACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009778.1-3863s1c1
Sequence:CCGGCCAGGCTACCTTCATGGTATTCTCGAGAATACCATGAAGGTAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009778.1-1623s1c1
Sequence:CCGGCCAGAGTTTATTCCTTCATTTCTCGAGAAATGAAGGAATAAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000066880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009778.1-717s1c1
Sequence:CCGGGCAGAGTTTGAGGTGAAGGAACTCGAGTTCCTTCACCTCAAACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009778
VALIDATED
C3 MISSION shRNA Lentiviral Transduction Particles
complement component 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009778.2-762s21c1
Sequence:CCGGGCAGAGTTTGAGGTGAAGGAACTCGAGTTCCTTCACCTCAAACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009778.2-364s21c1
Sequence:CCGGCCATCAAGATTCCAGCCAGTACTCGAGTACTGGCTGGAATCTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009778.2-1668s21c1
Sequence:CCGGCCAGAGTTTATTCCTTCATTTCTCGAGAAATGAAGGAATAAACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009778.2-901s21c1
Sequence:CCGGACGGGACAGCCTTCGTGATTTCTCGAGAAATCACGAAGGCTGTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009778.1-319s1c1
Sequence:CCGGCCATCAAGATTCCAGCCAGTACTCGAGTACTGGCTGGAATCTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009778.1-3422s1c1
Sequence:CCGGGCCCGTGATTCACCAAGAAATCTCGAGATTTCTTGGTGAATCACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009778.1-3863s1c1
Sequence:CCGGCCAGGCTACCTTCATGGTATTCTCGAGAATACCATGAAGGTAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009778.1-1623s1c1
Sequence:CCGGCCAGAGTTTATTCCTTCATTTCTCGAGAAATGAAGGAATAAACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000066880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009778.1-717s1c1
Sequence:CCGGGCAGAGTTTGAGGTGAAGGAACTCGAGTTCCTTCACCTCAAACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)