EMAIL THIS PAGE TO A FRIEND

C3AR1

complement component 3a receptor 1

51 Gene Product Result for
Synonyms: AZ3B C3AR HNFAG09
UniProtKB ID: Q16581, O43771, Q92868
Gene ID:
Mouse(12267) complement component 3a receptor 1
Rat(84007) complement component 3a receptor 1
Zebrafish(794255) C3a anaphylatoxin chemotactic receptor
cow(540702) complement component 3a receptor 1
domestic cat(101099383) complement component 3a receptor 1
dog(486704) complement component 3a receptor 1
chicken(418198) complement component 3a receptor 1
naked mole-rat(101710439) complement component 3a receptor 1
domestic guinea pig(100379246) complement component 3a receptor 1
sheep(101104226) complement component 3a receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004054 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009779 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009779 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009779 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004054 Rosetta Predictions human pricing
NM_032060 Rosetta Predictions rat pricing
NM_009779 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233551 predicted 1051
2 SASI_Hs01_00233552 predicted 593
3 SASI_Hs01_00233553 predicted 1279
4 SASI_Hs01_00233554 predicted 767
5 SASI_Hs01_00233555 predicted 428
6 SASI_Hs01_00233556 predicted 523
7 SASI_Hs01_00233557 predicted 1002
8 SASI_Hs01_00233558 predicted 917
9 SASI_Hs01_00233559 predicted 474
10 SASI_Hs01_00233560 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032060 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075092 predicted 1645
2 SASI_Rn01_00075093 predicted 417
3 SASI_Rn01_00075094 predicted 1035
4 SASI_Rn02_00265413 predicted 218
5 SASI_Rn01_00075095 predicted 633
6 SASI_Rn01_00075097 predicted 950
7 SASI_Rn01_00075098 predicted 1437
8 SASI_Rn01_00075099 predicted 1386
9 SASI_Rn01_00075100 predicted 583
10 SASI_Rn01_00075101 predicted 1151
11 SASI_Rn01_00075096 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009779 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088581 predicted 1121
2 SASI_Mm01_00088582 predicted 794
3 SASI_Mm01_00088583 predicted 1698
4 SASI_Mm01_00088585 predicted 1354
5 SASI_Mm01_00088586 predicted 578
6 SASI_Mm02_00317007 predicted 254
7 SASI_Mm01_00088587 predicted 1583
8 SASI_Mm01_00088588 predicted 1016
9 SASI_Mm01_00088589 predicted 680
10 SASI_Mm01_00088590 predicted 1492
11 SASI_Mm01_00088584 predicted 534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004054
C3AR1 MISSION shRNA Bacterial Glycerol Stock
complement component 3a receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004054.2-1576s1c1
Sequence:CCGGGCAATCACATAGTGAAAGTTTCTCGAGAAACTTTCACTATGTGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004054.2-596s1c1
Sequence:CCGGCCATAATAGATGTGGCTACAACTCGAGTTGTAGCCACATCTATTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004054.2-876s1c1
Sequence:CCGGGCTGATGTGGTCTCACCTAAACTCGAGTTTAGGTGAGACCACATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004054.2-1375s1c1
Sequence:CCGGGTTGCTTTAATCCCTTCCTTTCTCGAGAAAGGAAGGGATTAAAGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004054.2-769s1c1
Sequence:CCGGCCACTGTCTTCCAACCTCAAACTCGAGTTTGAGGTTGGAAGACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004054.2-583s21c1
Sequence:CCGGTCACTACAGACAACCATAATACTCGAGTATTATGGTTGTCTGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004054.2-561s21c1
Sequence:CCGGGTGTTCGTGTACCGGGAAATCCTCGAGGATTTCCCGGTACACGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004054.2-1025s21c1
Sequence:CCGGACAAGGTTTCCAGGATTATTACTCGAGTAATAATCCTGGAAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004054
C3AR1 MISSION shRNA shRNA Plasmid DNA
complement component 3a receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004054.2-1576s1c1
Sequence:CCGGGCAATCACATAGTGAAAGTTTCTCGAGAAACTTTCACTATGTGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004054.2-596s1c1
Sequence:CCGGCCATAATAGATGTGGCTACAACTCGAGTTGTAGCCACATCTATTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004054.2-876s1c1
Sequence:CCGGGCTGATGTGGTCTCACCTAAACTCGAGTTTAGGTGAGACCACATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004054.2-1375s1c1
Sequence:CCGGGTTGCTTTAATCCCTTCCTTTCTCGAGAAAGGAAGGGATTAAAGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004054.2-769s1c1
Sequence:CCGGCCACTGTCTTCCAACCTCAAACTCGAGTTTGAGGTTGGAAGACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004054.2-583s21c1
Sequence:CCGGTCACTACAGACAACCATAATACTCGAGTATTATGGTTGTCTGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004054.2-561s21c1
Sequence:CCGGGTGTTCGTGTACCGGGAAATCCTCGAGGATTTCCCGGTACACGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004054.2-1025s21c1
Sequence:CCGGACAAGGTTTCCAGGATTATTACTCGAGTAATAATCCTGGAAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004054
C3AR1 MISSION shRNA Lentiviral Transduction Particles
complement component 3a receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004054.2-1576s1c1
Sequence:CCGGGCAATCACATAGTGAAAGTTTCTCGAGAAACTTTCACTATGTGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004054.2-596s1c1
Sequence:CCGGCCATAATAGATGTGGCTACAACTCGAGTTGTAGCCACATCTATTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004054.2-876s1c1
Sequence:CCGGGCTGATGTGGTCTCACCTAAACTCGAGTTTAGGTGAGACCACATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004054.2-1375s1c1
Sequence:CCGGGTTGCTTTAATCCCTTCCTTTCTCGAGAAAGGAAGGGATTAAAGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004054.2-769s1c1
Sequence:CCGGCCACTGTCTTCCAACCTCAAACTCGAGTTTGAGGTTGGAAGACAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004054.2-583s21c1
Sequence:CCGGTCACTACAGACAACCATAATACTCGAGTATTATGGTTGTCTGTAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004054.2-561s21c1
Sequence:CCGGGTGTTCGTGTACCGGGAAATCCTCGAGGATTTCCCGGTACACGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004054.2-1025s21c1
Sequence:CCGGACAAGGTTTCCAGGATTATTACTCGAGTAATAATCCTGGAAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009779
C3AR1 MISSION shRNA Bacterial Glycerol Stock
complement component 3a receptor 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000027362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009779.1-610s1c1
Sequence:CCGGCCAGAAAGCAATTCTACTGATCTCGAGATCAGTAGAATTGCTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009779.1-324s1c1
Sequence:CCGGCCCATCCATCATTATTCTCAACTCGAGTTGAGAATAATGATGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009779.1-1416s1c1
Sequence:CCGGCCAAGACAAAGCCTCTTCAAACTCGAGTTTGAAGAGGCTTTGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009779.1-496s1c1
Sequence:CCGGCCCGTATTTGTATACCGTGATCTCGAGATCACGGTATACAAATACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009779
C3AR1 MISSION shRNA shRNA Plasmid DNA
complement component 3a receptor 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000027362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009779.1-610s1c1
Sequence:CCGGCCAGAAAGCAATTCTACTGATCTCGAGATCAGTAGAATTGCTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009779.1-324s1c1
Sequence:CCGGCCCATCCATCATTATTCTCAACTCGAGTTGAGAATAATGATGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009779.1-1416s1c1
Sequence:CCGGCCAAGACAAAGCCTCTTCAAACTCGAGTTTGAAGAGGCTTTGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009779.1-496s1c1
Sequence:CCGGCCCGTATTTGTATACCGTGATCTCGAGATCACGGTATACAAATACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009779
C3AR1 MISSION shRNA Lentiviral Transduction Particles
complement component 3a receptor 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000027362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009779.1-610s1c1
Sequence:CCGGCCAGAAAGCAATTCTACTGATCTCGAGATCAGTAGAATTGCTTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009779.1-324s1c1
Sequence:CCGGCCCATCCATCATTATTCTCAACTCGAGTTGAGAATAATGATGGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009779.1-1416s1c1
Sequence:CCGGCCAAGACAAAGCCTCTTCAAACTCGAGTTTGAAGAGGCTTTGTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009779.1-496s1c1
Sequence:CCGGCCCGTATTTGTATACCGTGATCTCGAGATCACGGTATACAAATACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks