EMAIL THIS PAGE TO A FRIEND

C3P1

complement component 3 precursor pseudogene

14 Gene Product Result for
Synonyms: CPLP
Species: Human C3P1(388503)
UniProtKB ID: Q6ZMU1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013640 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013640 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051568 predicted 1665
2 SASI_Hs01_00051570 predicted 2459
3 SASI_Hs02_00306410 predicted 2090
4 SASI_Hs01_00051572 predicted 1341
5 SASI_Hs01_00051573 predicted 2182
6 SASI_Hs01_00051574 predicted 2341
7 SASI_Hs01_00051575 predicted 2336
8 SASI_Hs01_00051576 predicted 1861
9 SASI_Hs01_00051577 predicted 1868
10 SASI_Hs02_00306411 predicted 2202
11 SASI_Hs01_00051569 predicted 1545
12 SASI_Hs01_00051571 predicted 2100
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013640
C3P1 MISSION shRNA Bacterial Glycerol Stock
complement component 3 precursor pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013640.1-1526s1c1
Sequence:CCGGGCGGAAGTGTTTATCAGTGTTCTCGAGAACACTGATAAACACTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013640.1-1303s1c1
Sequence:CCGGCCAAGCCATGTTGTACAATTTCTCGAGAAATTGTACAACATGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013640.1-1228s1c1
Sequence:CCGGGCTGACAGTTATGAAATCGTTCTCGAGAACGATTTCATAACTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013640.1-2102s1c1
Sequence:CCGGCCAGCAATGTGTTATTCATCACTCGAGTGATGAATAACACATTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013640.1-2459s1c1
Sequence:CCGGCCTGAATGTGAATTGGTACATCTCGAGATGTACCAATTCACATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013640
C3P1 MISSION shRNA shRNA Plasmid DNA
complement component 3 precursor pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013640.1-1526s1c1
Sequence:CCGGGCGGAAGTGTTTATCAGTGTTCTCGAGAACACTGATAAACACTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013640.1-1303s1c1
Sequence:CCGGCCAAGCCATGTTGTACAATTTCTCGAGAAATTGTACAACATGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013640.1-1228s1c1
Sequence:CCGGGCTGACAGTTATGAAATCGTTCTCGAGAACGATTTCATAACTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013640.1-2102s1c1
Sequence:CCGGCCAGCAATGTGTTATTCATCACTCGAGTGATGAATAACACATTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013640.1-2459s1c1
Sequence:CCGGCCTGAATGTGAATTGGTACATCTCGAGATGTACCAATTCACATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013640
C3P1 MISSION shRNA Lentiviral Transduction Particles
complement component 3 precursor pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013640.1-1526s1c1
Sequence:CCGGGCGGAAGTGTTTATCAGTGTTCTCGAGAACACTGATAAACACTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013640.1-1303s1c1
Sequence:CCGGCCAAGCCATGTTGTACAATTTCTCGAGAAATTGTACAACATGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013640.1-1228s1c1
Sequence:CCGGGCTGACAGTTATGAAATCGTTCTCGAGAACGATTTCATAACTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013640.1-2102s1c1
Sequence:CCGGCCAGCAATGTGTTATTCATCACTCGAGTGATGAATAACACATTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013640.1-2459s1c1
Sequence:CCGGCCTGAATGTGAATTGGTACATCTCGAGATGTACCAATTCACATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks