EMAIL THIS PAGE TO A FRIEND

C3orf14

chromosome 3 open reading frame 14

Species: Human C3orf14(57415)
UniProtKB ID: Q9HBI5, B2R9U0
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020685 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020685 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020685 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021171 MISSION® esiRNA esiRNA human C3orf14 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020685 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222273 predicted 360
2 SASI_Hs01_00222275 predicted 241
3 SASI_Hs01_00222276 predicted 213
4 SASI_Hs01_00222277 predicted 499
5 SASI_Hs01_00222278 predicted 527
6 SASI_Hs01_00222279 predicted 242
7 SASI_Hs01_00222280 predicted 408
8 SASI_Hs01_00222281 predicted 528
9 SASI_Hs01_00222282 predicted 504
10 SASI_Hs02_00353682 predicted 371
11 SASI_Hs01_00222274 predicted 221
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020685
C3orf14 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 14
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020685.3-504s21c1
Sequence:CCGGAGCGATAACTTCTTCACATGCCTCGAGGCATGTGAAGAAGTTATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020685.3-376s21c1
Sequence:CCGGGACTCGTTACTGGGCATCAGTCTCGAGACTGATGCCCAGTAACGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020685.3-559s21c1
Sequence:CCGGTAAGGTGTATGTAGGTTATTGCTCGAGCAATAACCTACATACACCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020685.3-384s21c1
Sequence:CCGGACTGGGCATCAGTAGAAGAATCTCGAGATTCTTCTACTGATGCCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020685.3-256s1c1
Sequence:CCGGCCAAACTGTTGAGACTGCTTTCTCGAGAAAGCAGTCTCAACAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020685.3-411s1c1
Sequence:CCGGCCAAATGGGAACAGTTTCTTTCTCGAGAAAGAAACTGTTCCCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020685.3-214s1c1
Sequence:CCGGGAATAAATTGGGTGATCAACACTCGAGTGTTGATCACCCAATTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020685.3-212s1c1
Sequence:CCGGGAGAATAAATTGGGTGATCAACTCGAGTTGATCACCCAATTTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020685.3-579s1c1
Sequence:CCGGGCAGGAACTTTAGGAATTAAACTCGAGTTTAATTCCTAAAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020685.3-357s1c1
Sequence:CCGGCTGAGGTGGTTTCTCTTGAGACTCGAGTCTCAAGAGAAACCACCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020685
C3orf14 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 14
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020685.3-504s21c1
Sequence:CCGGAGCGATAACTTCTTCACATGCCTCGAGGCATGTGAAGAAGTTATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020685.3-376s21c1
Sequence:CCGGGACTCGTTACTGGGCATCAGTCTCGAGACTGATGCCCAGTAACGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020685.3-559s21c1
Sequence:CCGGTAAGGTGTATGTAGGTTATTGCTCGAGCAATAACCTACATACACCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020685.3-384s21c1
Sequence:CCGGACTGGGCATCAGTAGAAGAATCTCGAGATTCTTCTACTGATGCCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020685.3-256s1c1
Sequence:CCGGCCAAACTGTTGAGACTGCTTTCTCGAGAAAGCAGTCTCAACAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020685.3-411s1c1
Sequence:CCGGCCAAATGGGAACAGTTTCTTTCTCGAGAAAGAAACTGTTCCCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020685.3-214s1c1
Sequence:CCGGGAATAAATTGGGTGATCAACACTCGAGTGTTGATCACCCAATTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020685.3-212s1c1
Sequence:CCGGGAGAATAAATTGGGTGATCAACTCGAGTTGATCACCCAATTTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020685.3-579s1c1
Sequence:CCGGGCAGGAACTTTAGGAATTAAACTCGAGTTTAATTCCTAAAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020685.3-357s1c1
Sequence:CCGGCTGAGGTGGTTTCTCTTGAGACTCGAGTCTCAAGAGAAACCACCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020685
C3orf14 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 14
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020685.3-504s21c1
Sequence:CCGGAGCGATAACTTCTTCACATGCCTCGAGGCATGTGAAGAAGTTATCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020685.3-376s21c1
Sequence:CCGGGACTCGTTACTGGGCATCAGTCTCGAGACTGATGCCCAGTAACGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020685.3-559s21c1
Sequence:CCGGTAAGGTGTATGTAGGTTATTGCTCGAGCAATAACCTACATACACCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020685.3-384s21c1
Sequence:CCGGACTGGGCATCAGTAGAAGAATCTCGAGATTCTTCTACTGATGCCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020685.3-256s1c1
Sequence:CCGGCCAAACTGTTGAGACTGCTTTCTCGAGAAAGCAGTCTCAACAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020685.3-411s1c1
Sequence:CCGGCCAAATGGGAACAGTTTCTTTCTCGAGAAAGAAACTGTTCCCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020685.3-214s1c1
Sequence:CCGGGAATAAATTGGGTGATCAACACTCGAGTGTTGATCACCCAATTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020685.3-212s1c1
Sequence:CCGGGAGAATAAATTGGGTGATCAACTCGAGTTGATCACCCAATTTATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020685.3-579s1c1
Sequence:CCGGGCAGGAACTTTAGGAATTAAACTCGAGTTTAATTCCTAAAGTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020685.3-357s1c1
Sequence:CCGGCTGAGGTGGTTTCTCTTGAGACTCGAGTCTCAAGAGAAACCACCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks