EMAIL THIS PAGE TO A FRIEND

C3orf17

chromosome 3 open reading frame 17

56 Gene Product Result for
Synonyms: NET17
Species: Human C3orf17(25871)
UniProtKB ID: Q6NW34, D3DN69, Q68DM6, Q9H7U0, Q9UFM4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015412 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034941 MISSION® esiRNA esiRNA human C3orf17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025072 Rosetta Predictions human pricing
NM_001025073 Rosetta Predictions human pricing
NM_015412 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207484 predicted 1599
2 SASI_Hs01_00207485 predicted 1507
3 SASI_Hs01_00207486 predicted 1281
4 SASI_Hs01_00207487 predicted 1170
5 SASI_Hs01_00207488 predicted 1391
6 SASI_Hs01_00207489 predicted 712
7 SASI_Hs01_00207490 predicted 1685
8 SASI_Hs01_00207491 predicted 458
9 SASI_Hs02_00307318 predicted 1146
10 SASI_Hs01_00207493 predicted 1445
11 SASI_Hs01_00207492 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198816 predicted 1603
2 SASI_Hs01_00198817 predicted 1504
3 SASI_Hs01_00198818 predicted 1268
4 SASI_Hs01_00198819 predicted 1163
5 SASI_Hs01_00198820 predicted 1385
6 SASI_Hs01_00198821 predicted 716
7 SASI_Hs01_00198822 predicted 1677
8 SASI_Hs01_00198823 predicted 458
9 SASI_Hs02_00307319 predicted 1142
10 SASI_Hs01_00198825 predicted 1444
11 SASI_Hs01_00198824 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037569 predicted 1752
2 SASI_Hs01_00037570 predicted 1662
3 SASI_Hs01_00037571 predicted 1426
4 SASI_Hs01_00037572 predicted 1317
5 SASI_Hs01_00037573 predicted 1546
6 SASI_Hs01_00037574 predicted 863
7 SASI_Hs01_00037575 predicted 1836
8 SASI_Hs01_00037576 predicted 613
9 SASI_Hs02_00347783 predicted 1296
10 SASI_Hs01_00037578 predicted 1594
11 SASI_Hs01_00037577 predicted 697
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015412
VALIDATED
C3orf17 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 17
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015412.1-1109s1c1
Sequence:CCGGGCTGAGTCCTTCACACAACTTCTCGAGAAGTTGTGTGAAGGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179493    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015412.1-1845s1c1
Sequence:CCGGGCACAGGAGTTCATTTCAGTTCTCGAGAACTGAAATGAACTCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015412.1-2168s1c1
Sequence:CCGGCCGCCTCTGAATACTAAAGTTCTCGAGAACTTTAGTATTCAGAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015412.1-1259s1c1
Sequence:CCGGCCAAAGAAACTAGAGTGCATACTCGAGTATGCACTCTAGTTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015412.3-1759s21c1
Sequence:CCGGAGTTTAGATGTTCGTTCATATCTCGAGATATGAACGAACATCTAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015412.3-606s21c1
Sequence:CCGGGGTTATGGGTTCTCTATAAAGCTCGAGCTTTATAGAGAACCCATAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015412
VALIDATED
C3orf17 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 17
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015412.1-1109s1c1
Sequence:CCGGGCTGAGTCCTTCACACAACTTCTCGAGAAGTTGTGTGAAGGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179493    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015412.1-1845s1c1
Sequence:CCGGGCACAGGAGTTCATTTCAGTTCTCGAGAACTGAAATGAACTCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015412.1-2168s1c1
Sequence:CCGGCCGCCTCTGAATACTAAAGTTCTCGAGAACTTTAGTATTCAGAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015412.1-1259s1c1
Sequence:CCGGCCAAAGAAACTAGAGTGCATACTCGAGTATGCACTCTAGTTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015412.3-1759s21c1
Sequence:CCGGAGTTTAGATGTTCGTTCATATCTCGAGATATGAACGAACATCTAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015412.3-606s21c1
Sequence:CCGGGGTTATGGGTTCTCTATAAAGCTCGAGCTTTATAGAGAACCCATAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015412
VALIDATED
C3orf17 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 17
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015412.1-1109s1c1
Sequence:CCGGGCTGAGTCCTTCACACAACTTCTCGAGAAGTTGTGTGAAGGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179493    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015412.1-1845s1c1
Sequence:CCGGGCACAGGAGTTCATTTCAGTTCTCGAGAACTGAAATGAACTCCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148921    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015412.1-2168s1c1
Sequence:CCGGCCGCCTCTGAATACTAAAGTTCTCGAGAACTTTAGTATTCAGAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015412.1-1259s1c1
Sequence:CCGGCCAAAGAAACTAGAGTGCATACTCGAGTATGCACTCTAGTTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015412.3-1759s21c1
Sequence:CCGGAGTTTAGATGTTCGTTCATATCTCGAGATATGAACGAACATCTAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015412.3-606s21c1
Sequence:CCGGGGTTATGGGTTCTCTATAAAGCTCGAGCTTTATAGAGAACCCATAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks