EMAIL THIS PAGE TO A FRIEND

C3orf18

chromosome 3 open reading frame 18

114 Gene Product Result for
Synonyms: G20
Species: Human C3orf18(51161)
UniProtKB ID: Q9UK00, C9JNP0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA012105 Anti-C3orf18 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2100303 Anti-C3ORF18 antibody produced in rabbit affinity isolated antibody canine, human, bovine, horse, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016210 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082161 MISSION® esiRNA esiRNA human C3orf18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016210 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242144 predicted 1471
2 SASI_Hs01_00242145 predicted 678
3 SASI_Hs01_00242146 predicted 1410
4 SASI_Hs01_00242148 predicted 1400
5 SASI_Hs01_00242147 predicted 1478
6 SASI_Hs01_00242149 predicted 1031
7 SASI_Hs01_00242150 predicted 896
8 SASI_Hs01_00242151 predicted 1265
9 SASI_Hs01_00242152 predicted 1180
10 SASI_Hs01_00242153 predicted 1005
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016210
VALIDATED
C3orf18 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 18
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016210.3-996s21c1
Sequence:CCGGGTTTACCGATGTGGCCAATGCCTCGAGGCATTGGCCACATCGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016210.3-1107s21c1
Sequence:CCGGGACCTACTCTGAAGATCTTCCCTCGAGGGAAGATCTTCAGAGTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016210.2-1483s1c1
Sequence:CCGGCCAAGTTATAGGGACAGGGTACTCGAGTACCCTGTCCCTATAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016210.2-789s1c1
Sequence:CCGGGAAGAAGAAGAGGCTGGAGAACTCGAGTTCTCCAGCCTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016210.2-666s1c1
Sequence:CCGGCACCTTTAATGACACCAGAATCTCGAGATTCTGGTGTCATTAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016210.2-1179s1c1
Sequence:CCGGCCTGCTGACTTTAGACTCTAACTCGAGTTAGAGTCTAAAGTCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016210.2-726s1c1
Sequence:CCGGGCTTCTGTCCTTTGGGATCATCTCGAGATGATCCCAAAGGACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016210.2-822s1c1
Sequence:CCGGGCTCATGCCCATGTACAACTTCTCGAGAAGTTGTACATGGGCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016210
VALIDATED
C3orf18 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 18
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016210.3-996s21c1
Sequence:CCGGGTTTACCGATGTGGCCAATGCCTCGAGGCATTGGCCACATCGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016210.3-1107s21c1
Sequence:CCGGGACCTACTCTGAAGATCTTCCCTCGAGGGAAGATCTTCAGAGTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016210.2-1483s1c1
Sequence:CCGGCCAAGTTATAGGGACAGGGTACTCGAGTACCCTGTCCCTATAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016210.2-789s1c1
Sequence:CCGGGAAGAAGAAGAGGCTGGAGAACTCGAGTTCTCCAGCCTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016210.2-666s1c1
Sequence:CCGGCACCTTTAATGACACCAGAATCTCGAGATTCTGGTGTCATTAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016210.2-1179s1c1
Sequence:CCGGCCTGCTGACTTTAGACTCTAACTCGAGTTAGAGTCTAAAGTCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016210.2-726s1c1
Sequence:CCGGGCTTCTGTCCTTTGGGATCATCTCGAGATGATCCCAAAGGACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016210.2-822s1c1
Sequence:CCGGGCTCATGCCCATGTACAACTTCTCGAGAAGTTGTACATGGGCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016210
VALIDATED
C3orf18 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 18
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016210.3-996s21c1
Sequence:CCGGGTTTACCGATGTGGCCAATGCCTCGAGGCATTGGCCACATCGGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016210.3-1107s21c1
Sequence:CCGGGACCTACTCTGAAGATCTTCCCTCGAGGGAAGATCTTCAGAGTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166347    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016210.2-1483s1c1
Sequence:CCGGCCAAGTTATAGGGACAGGGTACTCGAGTACCCTGTCCCTATAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016210.2-789s1c1
Sequence:CCGGGAAGAAGAAGAGGCTGGAGAACTCGAGTTCTCCAGCCTCTTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016210.2-666s1c1
Sequence:CCGGCACCTTTAATGACACCAGAATCTCGAGATTCTGGTGTCATTAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016210.2-1179s1c1
Sequence:CCGGCCTGCTGACTTTAGACTCTAACTCGAGTTAGAGTCTAAAGTCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165846    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016210.2-726s1c1
Sequence:CCGGGCTTCTGTCCTTTGGGATCATCTCGAGATGATCCCAAAGGACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016210.2-822s1c1
Sequence:CCGGGCTCATGCCCATGTACAACTTCTCGAGAAGTTGTACATGGGCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks