EMAIL THIS PAGE TO A FRIEND

C3orf20

chromosome 3 open reading frame 20

33 Gene Product Result for
Species: Human C3orf20(84077)
UniProtKB ID: Q8ND61, Q7L0U6, Q8NCP2, Q9H0I7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032137 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032137 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032137 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138511 MISSION® esiRNA esiRNA human C3orf20 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032137 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032137 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164854 predicted 2864
2 SASI_Hs01_00164856 predicted 2248
3 SASI_Hs01_00164857 predicted 2948
4 SASI_Hs01_00164858 predicted 412
5 SASI_Hs01_00164859 predicted 1721
6 SASI_Hs02_00359363 predicted 1814
7 SASI_Hs01_00164860 predicted 1470
8 SASI_Hs01_00164861 predicted 1753
9 SASI_Hs01_00164862 predicted 1347
10 SASI_Hs01_00164863 predicted 1552
11 SASI_Hs01_00164855 predicted 2187
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032137
C3orf20 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 20
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032137.2-2808s1c1
Sequence:CCGGCTTCCGGTCTCAACAGGATTACTCGAGTAATCCTGTTGAGACCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032137.2-1488s1c1
Sequence:CCGGCTTCAAGTTTCATTACACCTTCTCGAGAAGGTGTAATGAAACTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032137.2-1491s1c1
Sequence:CCGGCAAGTTTCATTACACCTTCTACTCGAGTAGAAGGTGTAATGAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160641    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032137.2-3186s1c1
Sequence:CCGGCCAAGCTTCTATAATAAACCACTCGAGTGGTTTATTATAGAAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032137.2-1996s1c1
Sequence:CCGGGCTGAGATCAAGAAGCGGTTTCTCGAGAAACCGCTTCTTGATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032137.3-1545s21c1
Sequence:CCGGGATGGCTCCTCCTTCGTTTACCTCGAGGTAAACGAAGGAGGAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032137.3-1571s21c1
Sequence:CCGGCTCTGGAAACGTCGCTGTATGCTCGAGCATACAGCGACGTTTCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032137.3-1264s21c1
Sequence:CCGGAGGAGTTGTGTCGCCACATAGCTCGAGCTATGTGGCGACACAACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032137
C3orf20 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 20
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032137.2-2808s1c1
Sequence:CCGGCTTCCGGTCTCAACAGGATTACTCGAGTAATCCTGTTGAGACCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032137.2-1488s1c1
Sequence:CCGGCTTCAAGTTTCATTACACCTTCTCGAGAAGGTGTAATGAAACTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032137.2-1491s1c1
Sequence:CCGGCAAGTTTCATTACACCTTCTACTCGAGTAGAAGGTGTAATGAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160641    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032137.2-3186s1c1
Sequence:CCGGCCAAGCTTCTATAATAAACCACTCGAGTGGTTTATTATAGAAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032137.2-1996s1c1
Sequence:CCGGGCTGAGATCAAGAAGCGGTTTCTCGAGAAACCGCTTCTTGATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032137.3-1545s21c1
Sequence:CCGGGATGGCTCCTCCTTCGTTTACCTCGAGGTAAACGAAGGAGGAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032137.3-1571s21c1
Sequence:CCGGCTCTGGAAACGTCGCTGTATGCTCGAGCATACAGCGACGTTTCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032137.3-1264s21c1
Sequence:CCGGAGGAGTTGTGTCGCCACATAGCTCGAGCTATGTGGCGACACAACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032137
C3orf20 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 20
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032137.2-2808s1c1
Sequence:CCGGCTTCCGGTCTCAACAGGATTACTCGAGTAATCCTGTTGAGACCGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032137.2-1488s1c1
Sequence:CCGGCTTCAAGTTTCATTACACCTTCTCGAGAAGGTGTAATGAAACTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032137.2-1491s1c1
Sequence:CCGGCAAGTTTCATTACACCTTCTACTCGAGTAGAAGGTGTAATGAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160641    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032137.2-3186s1c1
Sequence:CCGGCCAAGCTTCTATAATAAACCACTCGAGTGGTTTATTATAGAAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032137.2-1996s1c1
Sequence:CCGGGCTGAGATCAAGAAGCGGTTTCTCGAGAAACCGCTTCTTGATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032137.3-1545s21c1
Sequence:CCGGGATGGCTCCTCCTTCGTTTACCTCGAGGTAAACGAAGGAGGAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032137.3-1571s21c1
Sequence:CCGGCTCTGGAAACGTCGCTGTATGCTCGAGCATACAGCGACGTTTCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032137.3-1264s21c1
Sequence:CCGGAGGAGTTGTGTCGCCACATAGCTCGAGCTATGTGGCGACACAACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks