EMAIL THIS PAGE TO A FRIEND

C3orf27

chromosome 3 open reading frame 27

24 Gene Product Result for
Synonyms: GR6
Species: Human C3orf27(23434)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007354 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007354 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018905 predicted 969
2 SASI_Hs01_00018906 predicted 971
3 SASI_Hs01_00018907 predicted 970
4 SASI_Hs01_00018908 predicted 974
5 SASI_Hs01_00018909 predicted 975
6 SASI_Hs01_00018910 predicted 1386
7 SASI_Hs01_00018911 predicted 1427
8 SASI_Hs01_00018912 predicted 1382
9 SASI_Hs02_00343452 predicted 1243
10 SASI_Hs01_00018914 predicted 1904
11 SASI_Hs01_00018913 predicted 1124
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007354
C3orf27 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 27
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164521    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007354.1-1600s1c1
Sequence:CCGGCGTGTCTATCACAGTCAGTATCTCGAGATACTGACTGTGATAGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160937    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007354.1-1434s1c1
Sequence:CCGGGCTTCATTTGAATGAAGGGTTCTCGAGAACCCTTCATTCAAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007354.1-1390s1c1
Sequence:CCGGCAACTTTGCTTTCAGCTATTTCTCGAGAAATAGCTGAAAGCAAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007354.1-1389s1c1
Sequence:CCGGGCAACTTTGCTTTCAGCTATTCTCGAGAATAGCTGAAAGCAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007354.1-1387s1c1
Sequence:CCGGGAGCAACTTTGCTTTCAGCTACTCGAGTAGCTGAAAGCAAAGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161744    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007354.1-2078s1c1
Sequence:CCGGCCATTTATTCAGCACCTGTTACTCGAGTAACAGGTGCTGAATAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007354.1-1537s21c1
Sequence:CCGGATTTGCAGTGGTTTCACTAAACTCGAGTTTAGTGAAACCACTGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007354.1-1793s21c1
Sequence:CCGGAGGTGCAGTCAGCTCTATATTCTCGAGAATATAGAGCTGACTGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007354
C3orf27 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 27
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164521    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007354.1-1600s1c1
Sequence:CCGGCGTGTCTATCACAGTCAGTATCTCGAGATACTGACTGTGATAGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160937    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007354.1-1434s1c1
Sequence:CCGGGCTTCATTTGAATGAAGGGTTCTCGAGAACCCTTCATTCAAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007354.1-1390s1c1
Sequence:CCGGCAACTTTGCTTTCAGCTATTTCTCGAGAAATAGCTGAAAGCAAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007354.1-1389s1c1
Sequence:CCGGGCAACTTTGCTTTCAGCTATTCTCGAGAATAGCTGAAAGCAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007354.1-1387s1c1
Sequence:CCGGGAGCAACTTTGCTTTCAGCTACTCGAGTAGCTGAAAGCAAAGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161744    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007354.1-2078s1c1
Sequence:CCGGCCATTTATTCAGCACCTGTTACTCGAGTAACAGGTGCTGAATAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007354.1-1537s21c1
Sequence:CCGGATTTGCAGTGGTTTCACTAAACTCGAGTTTAGTGAAACCACTGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007354.1-1793s21c1
Sequence:CCGGAGGTGCAGTCAGCTCTATATTCTCGAGAATATAGAGCTGACTGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007354
C3orf27 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 27
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164521    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007354.1-1600s1c1
Sequence:CCGGCGTGTCTATCACAGTCAGTATCTCGAGATACTGACTGTGATAGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160937    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007354.1-1434s1c1
Sequence:CCGGGCTTCATTTGAATGAAGGGTTCTCGAGAACCCTTCATTCAAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007354.1-1390s1c1
Sequence:CCGGCAACTTTGCTTTCAGCTATTTCTCGAGAAATAGCTGAAAGCAAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160936    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007354.1-1389s1c1
Sequence:CCGGGCAACTTTGCTTTCAGCTATTCTCGAGAATAGCTGAAAGCAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007354.1-1387s1c1
Sequence:CCGGGAGCAACTTTGCTTTCAGCTACTCGAGTAGCTGAAAGCAAAGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161744    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007354.1-2078s1c1
Sequence:CCGGCCATTTATTCAGCACCTGTTACTCGAGTAACAGGTGCTGAATAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007354.1-1537s21c1
Sequence:CCGGATTTGCAGTGGTTTCACTAAACTCGAGTTTAGTGAAACCACTGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007354.1-1793s21c1
Sequence:CCGGAGGTGCAGTCAGCTCTATATTCTCGAGAATATAGAGCTGACTGCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks