EMAIL THIS PAGE TO A FRIEND

C3orf30

chromosome 3 open reading frame 30

28 Gene Product Result for
Synonyms: TSCPA
UniProtKB ID: Q96M34, A1L4B7
Gene ID:
chicken(770477) chromosome 1 open reading frame, human C3orf30
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152539 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152539 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152539 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144691 MISSION® esiRNA esiRNA human C3orf30 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152539 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245672 predicted 669
2 SASI_Hs01_00245673 predicted 1178
3 SASI_Hs01_00245675 predicted 910
4 SASI_Hs02_00366339 predicted 742
5 SASI_Hs01_00245676 predicted 1487
6 SASI_Hs01_00245677 predicted 1213
7 SASI_Hs02_00366340 predicted 1467
8 SASI_Hs01_00245678 predicted 1392
9 SASI_Hs01_00245679 predicted 1466
10 SASI_Hs01_00245680 predicted 790
11 SASI_Hs01_00245674 predicted 1418
12 SASI_Hs01_00245681 predicted 1207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152539
C3orf30 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 30
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152539.1-255s1c1
Sequence:CCGGCCAACGGAGTAGCTGAACAAACTCGAGTTTGTTCAGCTACTCCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152539.1-904s1c1
Sequence:CCGGGCAGACTGACCTCAGATTGTACTCGAGTACAATCTGAGGTCAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152539.1-223s1c1
Sequence:CCGGCCAGGCTGAATCCAGCATATTCTCGAGAATATGCTGGATTCAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152539.1-323s1c1
Sequence:CCGGGCTGATGTTTCTGACCTTAGACTCGAGTCTAAGGTCAGAAACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152539.1-1526s1c1
Sequence:CCGGCCTTACCAAGTTTCACTCCAACTCGAGTTGGAGTGAAACTTGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152539.1-234s1c1
Sequence:CCGGCCAGCATATTTAGCCAAGCTACTCGAGTAGCTTGGCTAAATATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152539.1-470s1c1
Sequence:CCGGGAACAGACTGAACGAAGATTACTCGAGTAATCTTCGTTCAGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152539.1-1459s1c1
Sequence:CCGGCCAAGGAAAGGGTTATCATATCTCGAGATATGATAACCCTTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152539.1-819s1c1
Sequence:CCGGGCAGAATGTCAGGGAAAGTTACTCGAGTAACTTTCCCTGACATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152539
C3orf30 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 30
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152539.1-255s1c1
Sequence:CCGGCCAACGGAGTAGCTGAACAAACTCGAGTTTGTTCAGCTACTCCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152539.1-904s1c1
Sequence:CCGGGCAGACTGACCTCAGATTGTACTCGAGTACAATCTGAGGTCAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152539.1-223s1c1
Sequence:CCGGCCAGGCTGAATCCAGCATATTCTCGAGAATATGCTGGATTCAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152539.1-323s1c1
Sequence:CCGGGCTGATGTTTCTGACCTTAGACTCGAGTCTAAGGTCAGAAACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152539.1-1526s1c1
Sequence:CCGGCCTTACCAAGTTTCACTCCAACTCGAGTTGGAGTGAAACTTGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152539.1-234s1c1
Sequence:CCGGCCAGCATATTTAGCCAAGCTACTCGAGTAGCTTGGCTAAATATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152539.1-470s1c1
Sequence:CCGGGAACAGACTGAACGAAGATTACTCGAGTAATCTTCGTTCAGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152539.1-1459s1c1
Sequence:CCGGCCAAGGAAAGGGTTATCATATCTCGAGATATGATAACCCTTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152539.1-819s1c1
Sequence:CCGGGCAGAATGTCAGGGAAAGTTACTCGAGTAACTTTCCCTGACATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152539
C3orf30 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 30
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152539.1-255s1c1
Sequence:CCGGCCAACGGAGTAGCTGAACAAACTCGAGTTTGTTCAGCTACTCCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152539.1-904s1c1
Sequence:CCGGGCAGACTGACCTCAGATTGTACTCGAGTACAATCTGAGGTCAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152539.1-223s1c1
Sequence:CCGGCCAGGCTGAATCCAGCATATTCTCGAGAATATGCTGGATTCAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152539.1-323s1c1
Sequence:CCGGGCTGATGTTTCTGACCTTAGACTCGAGTCTAAGGTCAGAAACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152539.1-1526s1c1
Sequence:CCGGCCTTACCAAGTTTCACTCCAACTCGAGTTGGAGTGAAACTTGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152539.1-234s1c1
Sequence:CCGGCCAGCATATTTAGCCAAGCTACTCGAGTAGCTTGGCTAAATATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152539.1-470s1c1
Sequence:CCGGGAACAGACTGAACGAAGATTACTCGAGTAATCTTCGTTCAGTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152539.1-1459s1c1
Sequence:CCGGCCAAGGAAAGGGTTATCATATCTCGAGATATGATAACCCTTTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152539.1-819s1c1
Sequence:CCGGGCAGAATGTCAGGGAAAGTTACTCGAGTAACTTTCCCTGACATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks