EMAIL THIS PAGE TO A FRIEND

C3orf33

chromosome 3 open reading frame 33

28 Gene Product Result for
Synonyms: AC3-33
UniProtKB ID: Q6P1S2, A8K1H5, Q86YE6, Q8IXA7, Q96NB5
Gene ID:
Zebrafish(565816) c3orf33 homolog (H. sapiens)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173657 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013201 MISSION® esiRNA esiRNA targeting human C3orf33 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173657 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029800 predicted 680
2 SASI_Hs01_00029801 predicted 722
3 SASI_Hs01_00029802 predicted 993
4 SASI_Hs01_00029803 predicted 976
5 SASI_Hs01_00029804 predicted 984
6 SASI_Hs01_00029805 predicted 1112
7 SASI_Hs01_00029806 predicted 1045
8 SASI_Hs01_00029807 predicted 474
9 SASI_Hs01_00029808 predicted 1025
10 SASI_Hs01_00029809 predicted 991
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173657
C3orf33 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 33
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173657.1-1260s1c1
Sequence:CCGGCCAGGCTGAATGATTTACATACTCGAGTATGTAAATCATTCAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173657.1-613s1c1
Sequence:CCGGCTGGTGAGTAAGGGTGGATATCTCGAGATATCCACCCTTACTCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173657.1-965s1c1
Sequence:CCGGGCTCCTTAATACTGAAGTTCACTCGAGTGAACTTCAGTATTAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173657.1-335s1c1
Sequence:CCGGCTTCGGATATTCCAGTAGAATCTCGAGATTCTACTGGAATATCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173657.1-392s1c1
Sequence:CCGGGCCGAATAACTGAGAATGGTTCTCGAGAACCATTCTCAGTTATTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173657.1-686s21c1
Sequence:CCGGTTCTTGTTAAAGGGCTTAAATCTCGAGATTTAAGCCCTTTAACAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173657.1-439s21c1
Sequence:CCGGTTACCTATTATAGCTTCATTGCTCGAGCAATGAAGCTATAATAGGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173657.1-370s21c1
Sequence:CCGGGTTAAACTACGTGGACGATTACTCGAGTAATCGTCCACGTAGTTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173657.1-1130s21c1
Sequence:CCGGGTGTTAGTCCAATGGTATTTACTCGAGTAAATACCATTGGACTAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173657.1-988s21c1
Sequence:CCGAGAACTTATAAGTCGCATAAACCTCGAGGTTTATGCGACTTATAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173657
C3orf33 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 33
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173657.1-1260s1c1
Sequence:CCGGCCAGGCTGAATGATTTACATACTCGAGTATGTAAATCATTCAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173657.1-613s1c1
Sequence:CCGGCTGGTGAGTAAGGGTGGATATCTCGAGATATCCACCCTTACTCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173657.1-965s1c1
Sequence:CCGGGCTCCTTAATACTGAAGTTCACTCGAGTGAACTTCAGTATTAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173657.1-335s1c1
Sequence:CCGGCTTCGGATATTCCAGTAGAATCTCGAGATTCTACTGGAATATCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173657.1-392s1c1
Sequence:CCGGGCCGAATAACTGAGAATGGTTCTCGAGAACCATTCTCAGTTATTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173657.1-686s21c1
Sequence:CCGGTTCTTGTTAAAGGGCTTAAATCTCGAGATTTAAGCCCTTTAACAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173657.1-439s21c1
Sequence:CCGGTTACCTATTATAGCTTCATTGCTCGAGCAATGAAGCTATAATAGGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173657.1-370s21c1
Sequence:CCGGGTTAAACTACGTGGACGATTACTCGAGTAATCGTCCACGTAGTTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173657.1-1130s21c1
Sequence:CCGGGTGTTAGTCCAATGGTATTTACTCGAGTAAATACCATTGGACTAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173657.1-988s21c1
Sequence:CCGAGAACTTATAAGTCGCATAAACCTCGAGGTTTATGCGACTTATAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173657
C3orf33 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 33
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173657.1-1260s1c1
Sequence:CCGGCCAGGCTGAATGATTTACATACTCGAGTATGTAAATCATTCAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173657.1-613s1c1
Sequence:CCGGCTGGTGAGTAAGGGTGGATATCTCGAGATATCCACCCTTACTCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173657.1-965s1c1
Sequence:CCGGGCTCCTTAATACTGAAGTTCACTCGAGTGAACTTCAGTATTAAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173657.1-335s1c1
Sequence:CCGGCTTCGGATATTCCAGTAGAATCTCGAGATTCTACTGGAATATCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173657.1-392s1c1
Sequence:CCGGGCCGAATAACTGAGAATGGTTCTCGAGAACCATTCTCAGTTATTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173657.1-686s21c1
Sequence:CCGGTTCTTGTTAAAGGGCTTAAATCTCGAGATTTAAGCCCTTTAACAAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173657.1-439s21c1
Sequence:CCGGTTACCTATTATAGCTTCATTGCTCGAGCAATGAAGCTATAATAGGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173657.1-370s21c1
Sequence:CCGGGTTAAACTACGTGGACGATTACTCGAGTAATCGTCCACGTAGTTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173657.1-1130s21c1
Sequence:CCGGGTGTTAGTCCAATGGTATTTACTCGAGTAAATACCATTGGACTAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173657.1-988s21c1
Sequence:CCGAGAACTTATAAGTCGCATAAACCTCGAGGTTTATGCGACTTATAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)