EMAIL THIS PAGE TO A FRIEND

C3orf35

chromosome 3 open reading frame 35

31 Gene Product Result for
Synonyms: APRG1
Species: Human C3orf35(339883)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178342 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178338 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178339 Rosetta Predictions human pricing
NM_178342 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068385 predicted 1137
2 SASI_Hs01_00068386 predicted 1209
3 SASI_Hs01_00068388 predicted 1137
4 SASI_Hs01_00068390 predicted 842
5 SASI_Hs01_00068391 predicted 693
6 SASI_Hs01_00068392 predicted 1183
7 SASI_Hs01_00068393 predicted 798
8 SASI_Hs02_00369641 predicted 1040
9 SASI_Hs01_00068394 predicted 848
10 SASI_Hs02_00369642 predicted 845
11 SASI_Hs01_00068387 predicted 1096
12 SASI_Hs01_00068389 predicted 1358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015445 predicted 975
2 SASI_Hs01_00015446 predicted 873
3 SASI_Hs01_00015448 predicted 889
4 SASI_Hs01_00015449 predicted 843
5 SASI_Hs01_00015450 predicted 699
6 SASI_Hs01_00015451 predicted 1203
7 SASI_Hs01_00015452 predicted 793
8 SASI_Hs01_00015453 predicted 777
9 SASI_Hs02_00369643 predicted 770
10 SASI_Hs01_00015454 predicted 807
11 SASI_Hs01_00015447 predicted 678
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178342
C3orf35 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 35
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000435395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178342.2-790s21c1
Sequence:CCGGTGGAATAATAAACAGAGGAAGCTCGAGCTTCCTCTGTTTATTATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178342.2-1017s21c1
Sequence:CCGGGCATTTGACATTCACTAATTTCTCGAGAAATTAGTGAATGTCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178342.2-893s21c1
Sequence:CCGGGATTGCATGCTGGTGTCTTTACTCGAGTAAAGACACCAGCATGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178342.2-1277s21c1
Sequence:CCGGTACACGGTAACAGCCTTATTACTCGAGTAATAAGGCTGTTACCGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178342
C3orf35 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 35
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000435395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178342.2-790s21c1
Sequence:CCGGTGGAATAATAAACAGAGGAAGCTCGAGCTTCCTCTGTTTATTATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178342.2-1017s21c1
Sequence:CCGGGCATTTGACATTCACTAATTTCTCGAGAAATTAGTGAATGTCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178342.2-893s21c1
Sequence:CCGGGATTGCATGCTGGTGTCTTTACTCGAGTAAAGACACCAGCATGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178342.2-1277s21c1
Sequence:CCGGTACACGGTAACAGCCTTATTACTCGAGTAATAAGGCTGTTACCGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178342
C3orf35 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 35
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000435395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178342.2-790s21c1
Sequence:CCGGTGGAATAATAAACAGAGGAAGCTCGAGCTTCCTCTGTTTATTATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178342.2-1017s21c1
Sequence:CCGGGCATTTGACATTCACTAATTTCTCGAGAAATTAGTGAATGTCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178342.2-893s21c1
Sequence:CCGGGATTGCATGCTGGTGTCTTTACTCGAGTAAAGACACCAGCATGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425547    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178342.2-1277s21c1
Sequence:CCGGTACACGGTAACAGCCTTATTACTCGAGTAATAAGGCTGTTACCGTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178338
C3orf35 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 35
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000166968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178338.2-1084s1c1
Sequence:CCGGGAATTGGAGGAGATTTAACACCTCGAGGTGTTAAATCTCCTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178338.2-1019s1c1
Sequence:CCGGCAGAACAGGCCCAGAATTTGACTCGAGTCAAATTCTGGGCCTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178338.2-1160s1c1
Sequence:CCGGCAGTGCTCAGCATTTCAACATCTCGAGATGTTGAAATGCTGAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178338.2-1021s1c1
Sequence:CCGGGAACAGGCCCAGAATTTGAAACTCGAGTTTCAAATTCTGGGCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178338
C3orf35 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 35
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000166968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178338.2-1084s1c1
Sequence:CCGGGAATTGGAGGAGATTTAACACCTCGAGGTGTTAAATCTCCTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178338.2-1019s1c1
Sequence:CCGGCAGAACAGGCCCAGAATTTGACTCGAGTCAAATTCTGGGCCTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178338.2-1160s1c1
Sequence:CCGGCAGTGCTCAGCATTTCAACATCTCGAGATGTTGAAATGCTGAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178338.2-1021s1c1
Sequence:CCGGGAACAGGCCCAGAATTTGAAACTCGAGTTTCAAATTCTGGGCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178338
C3orf35 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 35
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000166968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178338.2-1084s1c1
Sequence:CCGGGAATTGGAGGAGATTTAACACCTCGAGGTGTTAAATCTCCTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178338.2-1019s1c1
Sequence:CCGGCAGAACAGGCCCAGAATTTGACTCGAGTCAAATTCTGGGCCTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178338.2-1160s1c1
Sequence:CCGGCAGTGCTCAGCATTTCAACATCTCGAGATGTTGAAATGCTGAGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178338.2-1021s1c1
Sequence:CCGGGAACAGGCCCAGAATTTGAAACTCGAGTTTCAAATTCTGGGCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks