EMAIL THIS PAGE TO A FRIEND

C3orf36

chromosome 3 open reading frame 36

17 Gene Product Result for
Species: Human C3orf36(80111)
UniProtKB ID: Q3SXR2, Q3SXR3, Q9H6K8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025041 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025041 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024969 predicted 1178
2 SASI_Hs01_00024971 predicted 1521
3 SASI_Hs01_00024972 predicted 1461
4 SASI_Hs01_00024973 predicted 1447
5 SASI_Hs01_00024974 predicted 1448
6 SASI_Hs01_00024975 predicted 1534
7 SASI_Hs01_00024976 predicted 1183
8 SASI_Hs01_00024977 predicted 1156
9 SASI_Hs01_00024978 predicted 1170
10 SASI_Hs02_00357695 predicted 1088
11 SASI_Hs01_00024970 predicted 1446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025041
C3orf36 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 36
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183936    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025041.2-1527s1c1
Sequence:CCGGCCCAGTGTGACTAATCTCCTTCTCGAGAAGGAGATTAGTCACACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025041.1-1325s1c1
Sequence:CCGGGTCAGAAAGTCTCAGTCTCAACTCGAGTTGAGACTGAGACTTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025041.1-1321s1c1
Sequence:CCGGGAGAGTCAGAAAGTCTCAGTCCTCGAGGACTGAGACTTTCTGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025041.1-1285s1c1
Sequence:CCGGCTTCTCATCTGGGTGCTGGAACTCGAGTTCCAGCACCCAGATGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1178s21c1
Sequence:CCGGTTCCTAGCTCAGAGTACCCTCCTCGAGGAGGGTACTCTGAGCTAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1170s21c1
Sequence:CCGGGGAAGGCATTCCTAGCTCAGACTCGAGTCTGAGCTAGGAATGCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1064s21c1
Sequence:CCGGAGTAGTGGGCTCAGCCTAGTCCTCGAGGACTAGGCTGAGCCCACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1441s21c1
Sequence:CCGGGAACCCAAGGGTGAAACTGAGCTCGAGCTCAGTTTCACCCTTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1190s21c1
Sequence:CCGGAGTACCCTCCTGGAGTCTACACTCGAGTGTAGACTCCAGGAGGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1096s21c1
Sequence:CCGGGTTAGTGCTCACGTGTCTCTCCTCGAGGAGAGACACGTGAGCACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025041
C3orf36 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 36
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183936    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025041.2-1527s1c1
Sequence:CCGGCCCAGTGTGACTAATCTCCTTCTCGAGAAGGAGATTAGTCACACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025041.1-1325s1c1
Sequence:CCGGGTCAGAAAGTCTCAGTCTCAACTCGAGTTGAGACTGAGACTTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025041.1-1321s1c1
Sequence:CCGGGAGAGTCAGAAAGTCTCAGTCCTCGAGGACTGAGACTTTCTGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025041.1-1285s1c1
Sequence:CCGGCTTCTCATCTGGGTGCTGGAACTCGAGTTCCAGCACCCAGATGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1178s21c1
Sequence:CCGGTTCCTAGCTCAGAGTACCCTCCTCGAGGAGGGTACTCTGAGCTAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1170s21c1
Sequence:CCGGGGAAGGCATTCCTAGCTCAGACTCGAGTCTGAGCTAGGAATGCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1064s21c1
Sequence:CCGGAGTAGTGGGCTCAGCCTAGTCCTCGAGGACTAGGCTGAGCCCACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1441s21c1
Sequence:CCGGGAACCCAAGGGTGAAACTGAGCTCGAGCTCAGTTTCACCCTTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1190s21c1
Sequence:CCGGAGTACCCTCCTGGAGTCTACACTCGAGTGTAGACTCCAGGAGGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1096s21c1
Sequence:CCGGGTTAGTGCTCACGTGTCTCTCCTCGAGGAGAGACACGTGAGCACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025041
C3orf36 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 36
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183936    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025041.2-1527s1c1
Sequence:CCGGCCCAGTGTGACTAATCTCCTTCTCGAGAAGGAGATTAGTCACACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025041.1-1325s1c1
Sequence:CCGGGTCAGAAAGTCTCAGTCTCAACTCGAGTTGAGACTGAGACTTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025041.1-1321s1c1
Sequence:CCGGGAGAGTCAGAAAGTCTCAGTCCTCGAGGACTGAGACTTTCTGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025041.1-1285s1c1
Sequence:CCGGCTTCTCATCTGGGTGCTGGAACTCGAGTTCCAGCACCCAGATGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1178s21c1
Sequence:CCGGTTCCTAGCTCAGAGTACCCTCCTCGAGGAGGGTACTCTGAGCTAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1170s21c1
Sequence:CCGGGGAAGGCATTCCTAGCTCAGACTCGAGTCTGAGCTAGGAATGCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1064s21c1
Sequence:CCGGAGTAGTGGGCTCAGCCTAGTCCTCGAGGACTAGGCTGAGCCCACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1441s21c1
Sequence:CCGGGAACCCAAGGGTGAAACTGAGCTCGAGCTCAGTTTCACCCTTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1190s21c1
Sequence:CCGGAGTACCCTCCTGGAGTCTACACTCGAGTGTAGACTCCAGGAGGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025041.2-1096s21c1
Sequence:CCGGGTTAGTGCTCACGTGTCTCTCCTCGAGGAGAGACACGTGAGCACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks