EMAIL THIS PAGE TO A FRIEND

C3orf37

chromosome 3 open reading frame 37

Species: Human C3orf37(56941)
UniProtKB ID: Q96FZ2, A6NJR9, Q96G34, Q9NRP3
Gene ID:
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020187 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020187 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020187 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036741 MISSION® esiRNA esiRNA human C3orf37 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006109 Rosetta Predictions human pricing
NM_020187 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006109 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065581 predicted 775
2 SASI_Hs01_00065582 predicted 451
3 SASI_Hs01_00065583 predicted 553
4 SASI_Hs01_00065584 predicted 940
5 SASI_Hs01_00065585 predicted 1306
6 SASI_Hs01_00065586 predicted 774
7 SASI_Hs01_00065587 predicted 850
8 SASI_Hs01_00065588 predicted 719
9 SASI_Hs01_00065589 predicted 548
10 SASI_Hs02_00305065 predicted 710
11 SASI_Hs01_00065580 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093870 predicted 605
2 SASI_Hs01_00093871 predicted 273
3 SASI_Hs01_00093872 predicted 374
4 SASI_Hs01_00093873 predicted 765
5 SASI_Hs01_00093874 predicted 1130
6 SASI_Hs01_00093875 predicted 602
7 SASI_Hs01_00093876 predicted 680
8 SASI_Hs01_00093877 predicted 540
9 SASI_Hs01_00093878 predicted 375
10 SASI_Hs02_00353108 predicted 542
11 SASI_Hs01_00093869 predicted 322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020187
VALIDATED
C3orf37 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 37
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_020187.2-391s21c1
Sequence:CCGGCGTAATGGAGAAACGGTCATTCTCGAGAATGACCGTTTCTCCATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020187.2-279s21c1
Sequence:CCGGACTCATCTGAGCGTATCATTGCTCGAGCAATGATACGCTCAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020187.2-1202s21c1
Sequence:CCGGGATAATAGGTTCTTAACATTGCTCGAGCAATGTTAAGAACCTATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020187.2-720s21c1
Sequence:CCGGACAGGATGCCTGCCATATTAGCTCGAGCTAATATGGCAGGCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_020187.2-120s21c1
Sequence:CCGGGAGATGTTCTCACGAGAGCTTCTCGAGAAGCTCTCGTGAGAACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020187.1-133s1c1
Sequence:CCGGGAGATGTTCTCACGAGAGCTTCTCGAGAAGCTCTCGTGAGAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020187.1-129s1c1
Sequence:CCGGCCTAGAGATGTTCTCACGAGACTCGAGTCTCGTGAGAACATCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020187.1-472s1c1
Sequence:CCGGGATTCTATGAGTGGCAGCGATCTCGAGATCGCTGCCACTCATAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020187.1-404s1c1
Sequence:CCGGCGTAATGGAGAAACGGTCATTCTCGAGAATGACCGTTTCTCCATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020187.1-382s1c1
Sequence:CCGGCTACCAACTGTCGTAGTGATACTCGAGTATCACTACGACAGTTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020187.1-811s1c1
Sequence:CCGGCTCTGAAATTAATCCACCCAACTCGAGTTGGGTGGATTAATTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020187.1-762s1c1
Sequence:CCGGGAGGCAGTTTCTAAATGGCTTCTCGAGAAGCCATTTAGAAACTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020187
VALIDATED
C3orf37 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 37
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_020187.2-391s21c1
Sequence:CCGGCGTAATGGAGAAACGGTCATTCTCGAGAATGACCGTTTCTCCATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020187.2-279s21c1
Sequence:CCGGACTCATCTGAGCGTATCATTGCTCGAGCAATGATACGCTCAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020187.2-1202s21c1
Sequence:CCGGGATAATAGGTTCTTAACATTGCTCGAGCAATGTTAAGAACCTATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020187.2-720s21c1
Sequence:CCGGACAGGATGCCTGCCATATTAGCTCGAGCTAATATGGCAGGCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_020187.2-120s21c1
Sequence:CCGGGAGATGTTCTCACGAGAGCTTCTCGAGAAGCTCTCGTGAGAACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020187.1-133s1c1
Sequence:CCGGGAGATGTTCTCACGAGAGCTTCTCGAGAAGCTCTCGTGAGAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020187.1-129s1c1
Sequence:CCGGCCTAGAGATGTTCTCACGAGACTCGAGTCTCGTGAGAACATCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020187.1-472s1c1
Sequence:CCGGGATTCTATGAGTGGCAGCGATCTCGAGATCGCTGCCACTCATAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020187.1-404s1c1
Sequence:CCGGCGTAATGGAGAAACGGTCATTCTCGAGAATGACCGTTTCTCCATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020187.1-382s1c1
Sequence:CCGGCTACCAACTGTCGTAGTGATACTCGAGTATCACTACGACAGTTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020187.1-811s1c1
Sequence:CCGGCTCTGAAATTAATCCACCCAACTCGAGTTGGGTGGATTAATTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020187.1-762s1c1
Sequence:CCGGGAGGCAGTTTCTAAATGGCTTCTCGAGAAGCCATTTAGAAACTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020187
VALIDATED
C3orf37 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 37
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_020187.2-391s21c1
Sequence:CCGGCGTAATGGAGAAACGGTCATTCTCGAGAATGACCGTTTCTCCATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020187.2-279s21c1
Sequence:CCGGACTCATCTGAGCGTATCATTGCTCGAGCAATGATACGCTCAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020187.2-1202s21c1
Sequence:CCGGGATAATAGGTTCTTAACATTGCTCGAGCAATGTTAAGAACCTATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020187.2-720s21c1
Sequence:CCGGACAGGATGCCTGCCATATTAGCTCGAGCTAATATGGCAGGCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_020187.2-120s21c1
Sequence:CCGGGAGATGTTCTCACGAGAGCTTCTCGAGAAGCTCTCGTGAGAACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_020187.1-133s1c1
Sequence:CCGGGAGATGTTCTCACGAGAGCTTCTCGAGAAGCTCTCGTGAGAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020187.1-129s1c1
Sequence:CCGGCCTAGAGATGTTCTCACGAGACTCGAGTCTCGTGAGAACATCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020187.1-472s1c1
Sequence:CCGGGATTCTATGAGTGGCAGCGATCTCGAGATCGCTGCCACTCATAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_020187.1-404s1c1
Sequence:CCGGCGTAATGGAGAAACGGTCATTCTCGAGAATGACCGTTTCTCCATTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020187.1-382s1c1
Sequence:CCGGCTACCAACTGTCGTAGTGATACTCGAGTATCACTACGACAGTTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020187.1-811s1c1
Sequence:CCGGCTCTGAAATTAATCCACCCAACTCGAGTTGGGTGGATTAATTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020187.1-762s1c1
Sequence:CCGGGAGGCAGTTTCTAAATGGCTTCTCGAGAAGCCATTTAGAAACTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks