EMAIL THIS PAGE TO A FRIEND

C3orf38

chromosome 3 open reading frame 38

37 Gene Product Result for
Species: Human C3orf38(285237)
UniProtKB ID: Q5JPI3, B2R8X6, Q8TC85
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173824 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021211 MISSION® esiRNA esiRNA human C3orf38 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173824 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026077 predicted 816
2 SASI_Hs02_00368683 predicted 939
3 SASI_Hs01_00026078 predicted 999
4 SASI_Hs01_00026079 predicted 1130
5 SASI_Hs01_00026080 predicted 1020
6 SASI_Hs02_00368684 predicted 1021
7 SASI_Hs01_00026081 predicted 1012
8 SASI_Hs01_00026082 predicted 855
9 SASI_Hs01_00026084 predicted 821
10 SASI_Hs01_00026085 predicted 1043
11 SASI_Hs01_00026083 predicted 1076
12 SASI_Hs01_00026086 predicted 973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173824
VALIDATED
C3orf38 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 38
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173824.2-743s1c1
Sequence:CCGGCCTAGATTCACATGGACTGAACTCGAGTTCAGTCCATGTGAATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173824.2-949s1c1
Sequence:CCGGCATTACCGAAACCATCTGTTACTCGAGTAACAGATGGTTTCGGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173824.2-614s1c1
Sequence:CCGGGCATGATGTGAAGCTTAGGTTCTCGAGAACCTAAGCTTCACATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173824.2-249s1c1
Sequence:CCGGGCATACAGTCAAAGTGCAGAACTCGAGTTCTGCACTTTGACTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173824.2-1147s1c1
Sequence:CCGGGCTAAGTACTGTCAGCCTGAACTCGAGTTCAGGCTGACAGTACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173824.2-939s1c1
Sequence:CCGGGCTCCTGGAACATTACCGAAACTCGAGTTTCGGTAATGTTCCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173824.2-1134s1c1
Sequence:CCGGGACCCTCTAAAGCGCTAAGTACTCGAGTACTTAGCGCTTTAGAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173824
VALIDATED
C3orf38 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 38
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173824.2-743s1c1
Sequence:CCGGCCTAGATTCACATGGACTGAACTCGAGTTCAGTCCATGTGAATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173824.2-949s1c1
Sequence:CCGGCATTACCGAAACCATCTGTTACTCGAGTAACAGATGGTTTCGGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173824.2-614s1c1
Sequence:CCGGGCATGATGTGAAGCTTAGGTTCTCGAGAACCTAAGCTTCACATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173824.2-249s1c1
Sequence:CCGGGCATACAGTCAAAGTGCAGAACTCGAGTTCTGCACTTTGACTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173824.2-1147s1c1
Sequence:CCGGGCTAAGTACTGTCAGCCTGAACTCGAGTTCAGGCTGACAGTACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173824.2-939s1c1
Sequence:CCGGGCTCCTGGAACATTACCGAAACTCGAGTTTCGGTAATGTTCCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173824.2-1134s1c1
Sequence:CCGGGACCCTCTAAAGCGCTAAGTACTCGAGTACTTAGCGCTTTAGAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173824
VALIDATED
C3orf38 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 38
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173824.2-743s1c1
Sequence:CCGGCCTAGATTCACATGGACTGAACTCGAGTTCAGTCCATGTGAATCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173824.2-949s1c1
Sequence:CCGGCATTACCGAAACCATCTGTTACTCGAGTAACAGATGGTTTCGGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173824.2-614s1c1
Sequence:CCGGGCATGATGTGAAGCTTAGGTTCTCGAGAACCTAAGCTTCACATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173824.2-249s1c1
Sequence:CCGGGCATACAGTCAAAGTGCAGAACTCGAGTTCTGCACTTTGACTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157675    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173824.2-1147s1c1
Sequence:CCGGGCTAAGTACTGTCAGCCTGAACTCGAGTTCAGGCTGACAGTACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173824.2-939s1c1
Sequence:CCGGGCTCCTGGAACATTACCGAAACTCGAGTTTCGGTAATGTTCCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156972    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173824.2-1134s1c1
Sequence:CCGGGACCCTCTAAAGCGCTAAGTACTCGAGTACTTAGCGCTTTAGAGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks