EMAIL THIS PAGE TO A FRIEND

C3orf43

chromosome 3 open reading frame 43

55 Gene Product Result for
Synonyms: SMCO1
Species: Human C3orf43(255798)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001077657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077657 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU221621 MISSION® esiRNA esiRNA targeting human C3orf43 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077657 Rosetta Predictions human pricing
XM_173087 Rosetta Predictions human pricing
XM_931549 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313077 predicted 352
2 SASI_Hs02_00313078 predicted 383
3 SASI_Hs02_00313079 predicted 388
4 SASI_Hs02_00313080 predicted 498
5 SASI_Hs02_00313081 predicted 349
6 SASI_Hs02_00313082 predicted 501
7 SASI_Hs02_00313083 predicted 351
8 SASI_Hs02_00313084 predicted 505
9 SASI_Hs02_00313085 predicted 408
10 SASI_Hs02_00313086 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_173087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278617 predicted 392
2 SASI_Hs01_00278618 predicted 423
3 SASI_Hs01_00278619 predicted 422
4 SASI_Hs01_00278620 predicted 533
5 SASI_Hs01_00278621 predicted 538
6 SASI_Hs01_00278622 predicted 394
7 SASI_Hs01_00278623 predicted 540
8 SASI_Hs01_00278624 predicted 345
9 SASI_Hs01_00278625 predicted 487
10 SASI_Hs01_00278626 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300170 predicted 357
2 SASI_Hs01_00300171 predicted 384
3 SASI_Hs01_00300172 predicted 389
4 SASI_Hs01_00300173 predicted 492
5 SASI_Hs01_00300174 predicted 345
6 SASI_Hs01_00300175 predicted 500
7 SASI_Hs01_00300176 predicted 357
8 SASI_Hs01_00300177 predicted 500
9 SASI_Hs01_00300178 predicted 443
10 SASI_Hs01_00300179 predicted 544
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077657
C3orf43 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 43
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077657.1-605s21c1
Sequence:CCGGGCAGAACACTATACTGCTAAACTCGAGTTTAGCAGTATAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077657.1-645s21c1
Sequence:CCGGGGGATGTCACGTTCCTAATTACTCGAGTAATTAGGAACGTGACATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077657.1-705s21c1
Sequence:CCGGTGAGGGCTGTGCAGGTAATTGCTCGAGCAATTACCTGCACAGCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077657.1-391s21c1
Sequence:CCGGCTACGTCATTGAAGTACTTATCTCGAGATAAGTACTTCAATGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077657.1-1399s21c1
Sequence:CCGGAGCAATAGGAGGCAGGTAAATCTCGAGATTTACCTGCCTCCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077657
C3orf43 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 43
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077657.1-605s21c1
Sequence:CCGGGCAGAACACTATACTGCTAAACTCGAGTTTAGCAGTATAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077657.1-645s21c1
Sequence:CCGGGGGATGTCACGTTCCTAATTACTCGAGTAATTAGGAACGTGACATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077657.1-705s21c1
Sequence:CCGGTGAGGGCTGTGCAGGTAATTGCTCGAGCAATTACCTGCACAGCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077657.1-391s21c1
Sequence:CCGGCTACGTCATTGAAGTACTTATCTCGAGATAAGTACTTCAATGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077657.1-1399s21c1
Sequence:CCGGAGCAATAGGAGGCAGGTAAATCTCGAGATTTACCTGCCTCCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077657
C3orf43 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 43
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077657.1-605s21c1
Sequence:CCGGGCAGAACACTATACTGCTAAACTCGAGTTTAGCAGTATAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077657.1-645s21c1
Sequence:CCGGGGGATGTCACGTTCCTAATTACTCGAGTAATTAGGAACGTGACATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077657.1-705s21c1
Sequence:CCGGTGAGGGCTGTGCAGGTAATTGCTCGAGCAATTACCTGCACAGCCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077657.1-391s21c1
Sequence:CCGGCTACGTCATTGAAGTACTTATCTCGAGATAAGTACTTCAATGACGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077657.1-1399s21c1
Sequence:CCGGAGCAATAGGAGGCAGGTAAATCTCGAGATTTACCTGCCTCCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks