EMAIL THIS PAGE TO A FRIEND

C3orf52

chromosome 3 open reading frame 52

67 Gene Product Result for
Synonyms: TTMP
Species: Human C3orf52(79669)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024616 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024616 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024616 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026651 MISSION® esiRNA esiRNA human C3orf52 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024616 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356984 predicted 248
2 SASI_Hs01_00179915 predicted 701
3 SASI_Hs02_00356985 predicted 263
4 SASI_Hs01_00179916 predicted 309
5 SASI_Hs02_00356986 predicted 302
6 SASI_Hs02_00356987 predicted 364
7 SASI_Hs01_00179923 predicted 322
8 SASI_Hs02_00356988 predicted 296
9 SASI_Hs02_00356989 predicted 699
10 SASI_Hs02_00356990 predicted 644
11 SASI_Hs01_00179917 predicted 418
12 SASI_Hs01_00179918 predicted 647
13 SASI_Hs01_00179919 predicted 404
14 SASI_Hs01_00179920 predicted 436
15 SASI_Hs01_00179921 predicted 672
16 SASI_Hs01_00179922 predicted 359
17 SASI_Hs01_00179924 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024616
VALIDATED
C3orf52 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 52
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-167s21c1
Sequence:CCGGGACAAGGTCTTCCCTTCTTTGCTCGAGCAAAGAAGGGAAGACCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-702s21c1
Sequence:CCGGCAACATCCCTCTTGCTCTATGCTCGAGCATAGAGCAAGAGGGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-557s21c1
Sequence:CCGGGTAACGTATGACCTGCAATTTCTCGAGAAATTGCAGGTCATACGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-310s21c1
Sequence:CCGGAGTGATCATCATAGGCTTATGCTCGAGCATAAGCCTATGATGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-493s21c1
Sequence:CCGGGCCCTCTCTGAGTCGTTATTTCTCGAGAAATAACGACTCAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-227s21c1
Sequence:CCGGCCCTGGAGCTCCTGTAATAAGCTCGAGCTTATTACAGGAGCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024616.1-606s1c1
Sequence:CCGGGATCAGAATATACCTGGTTGTCTCGAGACAACCAGGTATATTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024616.1-463s1c1
Sequence:CCGGCAGTTGAAATAGTGGACTTCACTCGAGTGAAGTCCACTATTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024616.1-1358s1c1
Sequence:CCGGCCACCAAGGTTACTTTGAAATCTCGAGATTTCAAAGTAACCTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_024616.1-268s1c1
Sequence:CCGGGCTTATGTCTTGCTGCAGTAACTCGAGTTACTGCAGCAAGACATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024616.1-1190s1c1
Sequence:CCGGCCAATTATTCACTGAAGTCATCTCGAGATGACTTCAGTGAATAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024616
VALIDATED
C3orf52 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 52
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-167s21c1
Sequence:CCGGGACAAGGTCTTCCCTTCTTTGCTCGAGCAAAGAAGGGAAGACCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-702s21c1
Sequence:CCGGCAACATCCCTCTTGCTCTATGCTCGAGCATAGAGCAAGAGGGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-557s21c1
Sequence:CCGGGTAACGTATGACCTGCAATTTCTCGAGAAATTGCAGGTCATACGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-310s21c1
Sequence:CCGGAGTGATCATCATAGGCTTATGCTCGAGCATAAGCCTATGATGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-493s21c1
Sequence:CCGGGCCCTCTCTGAGTCGTTATTTCTCGAGAAATAACGACTCAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-227s21c1
Sequence:CCGGCCCTGGAGCTCCTGTAATAAGCTCGAGCTTATTACAGGAGCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024616.1-606s1c1
Sequence:CCGGGATCAGAATATACCTGGTTGTCTCGAGACAACCAGGTATATTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024616.1-463s1c1
Sequence:CCGGCAGTTGAAATAGTGGACTTCACTCGAGTGAAGTCCACTATTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024616.1-1358s1c1
Sequence:CCGGCCACCAAGGTTACTTTGAAATCTCGAGATTTCAAAGTAACCTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_024616.1-268s1c1
Sequence:CCGGGCTTATGTCTTGCTGCAGTAACTCGAGTTACTGCAGCAAGACATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024616.1-1190s1c1
Sequence:CCGGCCAATTATTCACTGAAGTCATCTCGAGATGACTTCAGTGAATAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024616
VALIDATED
C3orf52 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 52
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-167s21c1
Sequence:CCGGGACAAGGTCTTCCCTTCTTTGCTCGAGCAAAGAAGGGAAGACCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-702s21c1
Sequence:CCGGCAACATCCCTCTTGCTCTATGCTCGAGCATAGAGCAAGAGGGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-557s21c1
Sequence:CCGGGTAACGTATGACCTGCAATTTCTCGAGAAATTGCAGGTCATACGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-310s21c1
Sequence:CCGGAGTGATCATCATAGGCTTATGCTCGAGCATAAGCCTATGATGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-493s21c1
Sequence:CCGGGCCCTCTCTGAGTCGTTATTTCTCGAGAAATAACGACTCAGAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024616.2-227s21c1
Sequence:CCGGCCCTGGAGCTCCTGTAATAAGCTCGAGCTTATTACAGGAGCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024616.1-606s1c1
Sequence:CCGGGATCAGAATATACCTGGTTGTCTCGAGACAACCAGGTATATTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024616.1-463s1c1
Sequence:CCGGCAGTTGAAATAGTGGACTTCACTCGAGTGAAGTCCACTATTTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144394    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024616.1-1358s1c1
Sequence:CCGGCCACCAAGGTTACTTTGAAATCTCGAGATTTCAAAGTAACCTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_024616.1-268s1c1
Sequence:CCGGGCTTATGTCTTGCTGCAGTAACTCGAGTTACTGCAGCAAGACATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_024616.1-1190s1c1
Sequence:CCGGCCAATTATTCACTGAAGTCATCTCGAGATGACTTCAGTGAATAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks