EMAIL THIS PAGE TO A FRIEND

C3orf55

chromosome 3 open reading frame 55

106 Gene Product Result for
Species: Human C3orf55(152078)
UniProtKB ID: A1A4F0, C9JP04, C9JXB5, Q8N6Q6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099777 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099777 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099777 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022111 MISSION® esiRNA esiRNA human C3orf55 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099777 Rosetta Predictions human pricing
XM_496664 Rosetta Predictions human pricing
XM_934798 Rosetta Predictions human pricing
XM_934799 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321408 predicted 354
2 SASI_Hs02_00321409 predicted 398
3 SASI_Hs02_00321410 predicted 198
4 SASI_Hs02_00321411 predicted 346
5 SASI_Hs02_00321412 predicted 406
6 SASI_Hs02_00321413 predicted 339
7 SASI_Hs02_00321414 predicted 337
8 SASI_Hs02_00321415 predicted 233
9 SASI_Hs02_00321416 predicted 345
10 SASI_Hs02_00321417 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250520 predicted 215
2 SASI_Hs01_00250521 predicted 261
3 SASI_Hs01_00250522 predicted 253
4 SASI_Hs01_00250523 predicted 260
5 SASI_Hs01_00250524 predicted 269
6 SASI_Hs01_00250525 predicted 213
7 SASI_Hs01_00250526 predicted 272
8 SASI_Hs01_00250527 predicted 206
9 SASI_Hs01_00250528 predicted 206
10 SASI_Hs01_00250529 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286739 predicted 214
2 SASI_Hs01_00286740 predicted 222
3 SASI_Hs01_00286741 predicted 203
4 SASI_Hs01_00286742 predicted 222
5 SASI_Hs01_00286743 predicted 210
6 SASI_Hs01_00286744 predicted 207
7 SASI_Hs01_00286745 predicted 257
8 SASI_Hs01_00286746 predicted 255
9 SASI_Hs01_00286747 predicted 219
10 SASI_Hs01_00286748 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276299 predicted 334
2 SASI_Hs01_00276300 predicted 510
3 SASI_Hs01_00276301 predicted 380
4 SASI_Hs01_00276302 predicted 333
5 SASI_Hs01_00276303 predicted 383
6 SASI_Hs01_00276304 predicted 314
7 SASI_Hs01_00276305 predicted 319
8 SASI_Hs01_00276306 predicted 205
9 SASI_Hs01_00276307 predicted 330
10 SASI_Hs01_00276308 predicted 363
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099777
C3orf55 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 55
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099777.2-399s21c1
Sequence:CCGGCGACATGAACACGGATGTAATCTCGAGATTACATCCGTGTTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099777.2-483s21c1
Sequence:CCGGTCTACGGAAGGAACTTCATTTCTCGAGAAATGAAGTTCCTTCCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099777.2-322s21c1
Sequence:CCGGATAGGTGGAGACCTGACAAATCTCGAGATTTGTCAGGTCTCCACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099777.2-432s21c1
Sequence:CCGGATTCATGTACTACAGGTTAAACTCGAGTTTAACCTGTAGTACATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099777.2-766s21c1
Sequence:CCGGTAGCTAATGCTATAGTCATTTCTCGAGAAATGACTATAGCATTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099777
C3orf55 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 55
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099777.2-399s21c1
Sequence:CCGGCGACATGAACACGGATGTAATCTCGAGATTACATCCGTGTTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099777.2-483s21c1
Sequence:CCGGTCTACGGAAGGAACTTCATTTCTCGAGAAATGAAGTTCCTTCCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099777.2-322s21c1
Sequence:CCGGATAGGTGGAGACCTGACAAATCTCGAGATTTGTCAGGTCTCCACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099777.2-432s21c1
Sequence:CCGGATTCATGTACTACAGGTTAAACTCGAGTTTAACCTGTAGTACATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099777.2-766s21c1
Sequence:CCGGTAGCTAATGCTATAGTCATTTCTCGAGAAATGACTATAGCATTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099777
C3orf55 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 55
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099777.2-399s21c1
Sequence:CCGGCGACATGAACACGGATGTAATCTCGAGATTACATCCGTGTTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099777.2-483s21c1
Sequence:CCGGTCTACGGAAGGAACTTCATTTCTCGAGAAATGAAGTTCCTTCCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099777.2-322s21c1
Sequence:CCGGATAGGTGGAGACCTGACAAATCTCGAGATTTGTCAGGTCTCCACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099777.2-432s21c1
Sequence:CCGGATTCATGTACTACAGGTTAAACTCGAGTTTAACCTGTAGTACATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099777.2-766s21c1
Sequence:CCGGTAGCTAATGCTATAGTCATTTCTCGAGAAATGACTATAGCATTAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks