EMAIL THIS PAGE TO A FRIEND

C3orf56

chromosome 3 open reading frame 56

95 Gene Product Result for
Species: Human C3orf56(285311)
UniProtKB ID: Q8N813, B2RNW5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007534 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007534 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007534 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007534 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123449 predicted 530
2 SASI_Hs01_00123450 predicted 465
3 SASI_Hs01_00123451 predicted 1063
4 SASI_Hs01_00123452 predicted 581
5 SASI_Hs01_00123453 predicted 1249
6 SASI_Hs01_00123454 predicted 1270
7 SASI_Hs01_00123455 predicted 765
8 SASI_Hs01_00123456 predicted 1226
9 SASI_Hs01_00123457 predicted 1047
10 SASI_Hs01_00123458 predicted 1288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007534
C3orf56 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 56
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-633s1c1
Sequence:CCGGCATGAAATTCCCACCCACCTACTCGAGTAGGTGGGTGGGAATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-420s1c1
Sequence:CCGGCATCTACTCCTGCATGGGATTCTCGAGAATCCCATGCAGGAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-882s1c1
Sequence:CCGGCATTGAAGATTCTCAGCTGGACTCGAGTCCAGCTGAGAATCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007534.1-1069s1c1
Sequence:CCGGGTTGTTTACTATTCCTCAGTACTCGAGTACTGAGGAATAGTAAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160517    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007534.1-1121s1c1
Sequence:CCGGCCTCTATTTGCTATTTCTCTTCTCGAGAAGAGAAATAGCAAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-772s1c1
Sequence:CCGGCCCTACTTGAAGACATGCAAACTCGAGTTTGCATGTCTTCAAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-579s1c1
Sequence:CCGGCCTCATAGGAAGTCCGTATCTCTCGAGAGATACGGACTTCCTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165499    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007534.1-1492s1c1
Sequence:CCGGGCACTTTGGAACCCATGGAATCTCGAGATTCCATGGGTTCCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-819s1c1
Sequence:CCGGGTTCGGTATTTGGGCACCTTTCTCGAGAAAGGTGCCCAAATACCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-486s1c1
Sequence:CCGGCTATGGTGGGTATCTCTGGATCTCGAGATCCAGAGATACCCACCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007534
C3orf56 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 56
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-633s1c1
Sequence:CCGGCATGAAATTCCCACCCACCTACTCGAGTAGGTGGGTGGGAATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-420s1c1
Sequence:CCGGCATCTACTCCTGCATGGGATTCTCGAGAATCCCATGCAGGAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-882s1c1
Sequence:CCGGCATTGAAGATTCTCAGCTGGACTCGAGTCCAGCTGAGAATCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007534.1-1069s1c1
Sequence:CCGGGTTGTTTACTATTCCTCAGTACTCGAGTACTGAGGAATAGTAAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160517    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007534.1-1121s1c1
Sequence:CCGGCCTCTATTTGCTATTTCTCTTCTCGAGAAGAGAAATAGCAAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-772s1c1
Sequence:CCGGCCCTACTTGAAGACATGCAAACTCGAGTTTGCATGTCTTCAAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-579s1c1
Sequence:CCGGCCTCATAGGAAGTCCGTATCTCTCGAGAGATACGGACTTCCTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165499    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007534.1-1492s1c1
Sequence:CCGGGCACTTTGGAACCCATGGAATCTCGAGATTCCATGGGTTCCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-819s1c1
Sequence:CCGGGTTCGGTATTTGGGCACCTTTCTCGAGAAAGGTGCCCAAATACCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-486s1c1
Sequence:CCGGCTATGGTGGGTATCTCTGGATCTCGAGATCCAGAGATACCCACCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007534
C3orf56 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 56
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-633s1c1
Sequence:CCGGCATGAAATTCCCACCCACCTACTCGAGTAGGTGGGTGGGAATTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-420s1c1
Sequence:CCGGCATCTACTCCTGCATGGGATTCTCGAGAATCCCATGCAGGAGTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-882s1c1
Sequence:CCGGCATTGAAGATTCTCAGCTGGACTCGAGTCCAGCTGAGAATCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007534.1-1069s1c1
Sequence:CCGGGTTGTTTACTATTCCTCAGTACTCGAGTACTGAGGAATAGTAAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160517    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007534.1-1121s1c1
Sequence:CCGGCCTCTATTTGCTATTTCTCTTCTCGAGAAGAGAAATAGCAAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-772s1c1
Sequence:CCGGCCCTACTTGAAGACATGCAAACTCGAGTTTGCATGTCTTCAAGTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-579s1c1
Sequence:CCGGCCTCATAGGAAGTCCGTATCTCTCGAGAGATACGGACTTCCTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165499    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007534.1-1492s1c1
Sequence:CCGGGCACTTTGGAACCCATGGAATCTCGAGATTCCATGGGTTCCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-819s1c1
Sequence:CCGGGTTCGGTATTTGGGCACCTTTCTCGAGAAAGGTGCCCAAATACCGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007534.1-486s1c1
Sequence:CCGGCTATGGTGGGTATCTCTGGATCTCGAGATCCAGAGATACCCACCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks