EMAIL THIS PAGE TO A FRIEND

C3orf58

chromosome 3 open reading frame 58

126 Gene Product Result for
Synonyms: DIA1 HASF
UniProtKB ID: Q8NDZ4, B2RCF2, B7Z1W3
Gene ID:
chicken(424771) chromosome 9 open reading frame, human C3orf58
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173552 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129471 MISSION® esiRNA esiRNA human C3orf58 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173552 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184632 predicted 1038
2 SASI_Hs02_00368362 predicted 1089
3 SASI_Hs01_00184633 predicted 1332
4 SASI_Hs01_00184634 predicted 1253
5 SASI_Hs01_00184636 predicted 994
6 SASI_Hs01_00184637 predicted 1469
7 SASI_Hs01_00184639 predicted 929
8 SASI_Hs01_00184640 predicted 1265
9 SASI_Hs01_00184641 predicted 1011
10 SASI_Hs02_00368363 predicted 1551
11 SASI_Hs01_00184635 predicted 1334
12 SASI_Hs01_00184638 predicted 1149
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173552
C3orf58 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 58
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173552.2-2779s1c1
Sequence:CCGGCCTAAGGGTTAAACATCAGAACTCGAGTTCTGATGTTTAACCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173552.2-3891s1c1
Sequence:CCGGGCCCATTAATAGACGCAGTAACTCGAGTTACTGCGTCTATTAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173552.2-950s1c1
Sequence:CCGGGCAAAGTATCTTGGAGCTTGTCTCGAGACAAGCTCCAAGATACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173552.2-1073s1c1
Sequence:CCGGGCAGAACAGCTTACAAACAATCTCGAGATTGTTTGTAAGCTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173552.2-2224s1c1
Sequence:CCGGGCATGGTGTCATTTCAGGTTACTCGAGTAACCTGAAATGACACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173552.3-1943s21c1
Sequence:CCGGACTTGCACTGATAGATCTTAACTCGAGTTAAGATCTATCAGTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173552.3-1789s21c1
Sequence:CCGGGCGTGAATACCTAGCACAATTCTCGAGAATTGTGCTAGGTATTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173552.3-2152s21c1
Sequence:CCGGCAAAGGGTACTTGGTACTTAGCTCGAGCTAAGTACCAAGTACCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173552.3-1318s21c1
Sequence:CCGGTGACCTCGCTTGGCAATTAATCTCGAGATTAATTGCCAAGCGAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173552
C3orf58 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 58
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173552.2-2779s1c1
Sequence:CCGGCCTAAGGGTTAAACATCAGAACTCGAGTTCTGATGTTTAACCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173552.2-3891s1c1
Sequence:CCGGGCCCATTAATAGACGCAGTAACTCGAGTTACTGCGTCTATTAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173552.2-950s1c1
Sequence:CCGGGCAAAGTATCTTGGAGCTTGTCTCGAGACAAGCTCCAAGATACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173552.2-1073s1c1
Sequence:CCGGGCAGAACAGCTTACAAACAATCTCGAGATTGTTTGTAAGCTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173552.2-2224s1c1
Sequence:CCGGGCATGGTGTCATTTCAGGTTACTCGAGTAACCTGAAATGACACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173552.3-1943s21c1
Sequence:CCGGACTTGCACTGATAGATCTTAACTCGAGTTAAGATCTATCAGTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173552.3-1789s21c1
Sequence:CCGGGCGTGAATACCTAGCACAATTCTCGAGAATTGTGCTAGGTATTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173552.3-2152s21c1
Sequence:CCGGCAAAGGGTACTTGGTACTTAGCTCGAGCTAAGTACCAAGTACCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173552.3-1318s21c1
Sequence:CCGGTGACCTCGCTTGGCAATTAATCTCGAGATTAATTGCCAAGCGAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173552
C3orf58 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 58
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129727    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173552.2-2779s1c1
Sequence:CCGGCCTAAGGGTTAAACATCAGAACTCGAGTTCTGATGTTTAACCCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173552.2-3891s1c1
Sequence:CCGGGCCCATTAATAGACGCAGTAACTCGAGTTACTGCGTCTATTAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173552.2-950s1c1
Sequence:CCGGGCAAAGTATCTTGGAGCTTGTCTCGAGACAAGCTCCAAGATACTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173552.2-1073s1c1
Sequence:CCGGGCAGAACAGCTTACAAACAATCTCGAGATTGTTTGTAAGCTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173552.2-2224s1c1
Sequence:CCGGGCATGGTGTCATTTCAGGTTACTCGAGTAACCTGAAATGACACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173552.3-1943s21c1
Sequence:CCGGACTTGCACTGATAGATCTTAACTCGAGTTAAGATCTATCAGTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173552.3-1789s21c1
Sequence:CCGGGCGTGAATACCTAGCACAATTCTCGAGAATTGTGCTAGGTATTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173552.3-2152s21c1
Sequence:CCGGCAAAGGGTACTTGGTACTTAGCTCGAGCTAAGTACCAAGTACCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173552.3-1318s21c1
Sequence:CCGGTGACCTCGCTTGGCAATTAATCTCGAGATTAATTGCCAAGCGAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks