EMAIL THIS PAGE TO A FRIEND

C3orf62

chromosome 3 open reading frame 62

39 Gene Product Result for
Species: Human C3orf62(375341)
UniProtKB ID: Q6ZUJ4, Q6P7E9, Q7Z3X6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198562 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009071 MISSION® esiRNA esiRNA targeting human C3orf62 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198562 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118666 predicted 899
2 SASI_Hs01_00118667 predicted 222
3 SASI_Hs01_00118668 predicted 501
4 SASI_Hs01_00118669 predicted 235
5 SASI_Hs01_00118670 predicted 680
6 SASI_Hs01_00118671 predicted 935
7 SASI_Hs01_00118672 predicted 217
8 SASI_Hs01_00118673 predicted 528
9 SASI_Hs01_00118674 predicted 651
10 SASI_Hs01_00118675 predicted 402
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198562
C3orf62 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 62
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198562.2-1192s21c1
Sequence:CCGGTGCTTTGAAATGTTTCCTATTCTCGAGAATAGGAAACATTTCAAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198562.2-999s21c1
Sequence:CCGGATTGAGTAAGGACAGTTATCTCTCGAGAGATAACTGTCCTTACTCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198562.2-721s21c1
Sequence:CCGGAGGATCTGCTTGATATGATTGCTCGAGCAATCATATCAAGCAGATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198562.2-1106s21c1
Sequence:CCGGGGTTGGCAGAACCTGAATTACCTCGAGGTAATTCAGGTTCTGCCAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198562.1-772s1c1
Sequence:CCGGGATTCACCCTTCAAAGAGGAACTCGAGTTCCTCTTTGAAGGGTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198562.1-594s1c1
Sequence:CCGGGAAAGATATGGAGAGAGATTTCTCGAGAAATCTCTCTCCATATCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198562.1-886s1c1
Sequence:CCGGGAGACTGTTCTGGACTTGGAACTCGAGTTCCAAGTCCAGAACAGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198562.1-2133s1c1
Sequence:CCGGGCCCGAACAAACCAAAGAGTTCTCGAGAACTCTTTGGTTTGTTCGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198562
C3orf62 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 62
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198562.2-1192s21c1
Sequence:CCGGTGCTTTGAAATGTTTCCTATTCTCGAGAATAGGAAACATTTCAAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198562.2-999s21c1
Sequence:CCGGATTGAGTAAGGACAGTTATCTCTCGAGAGATAACTGTCCTTACTCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198562.2-721s21c1
Sequence:CCGGAGGATCTGCTTGATATGATTGCTCGAGCAATCATATCAAGCAGATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198562.2-1106s21c1
Sequence:CCGGGGTTGGCAGAACCTGAATTACCTCGAGGTAATTCAGGTTCTGCCAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198562.1-772s1c1
Sequence:CCGGGATTCACCCTTCAAAGAGGAACTCGAGTTCCTCTTTGAAGGGTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198562.1-594s1c1
Sequence:CCGGGAAAGATATGGAGAGAGATTTCTCGAGAAATCTCTCTCCATATCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198562.1-886s1c1
Sequence:CCGGGAGACTGTTCTGGACTTGGAACTCGAGTTCCAAGTCCAGAACAGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198562.1-2133s1c1
Sequence:CCGGGCCCGAACAAACCAAAGAGTTCTCGAGAACTCTTTGGTTTGTTCGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198562
C3orf62 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 62
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198562.2-1192s21c1
Sequence:CCGGTGCTTTGAAATGTTTCCTATTCTCGAGAATAGGAAACATTTCAAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198562.2-999s21c1
Sequence:CCGGATTGAGTAAGGACAGTTATCTCTCGAGAGATAACTGTCCTTACTCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198562.2-721s21c1
Sequence:CCGGAGGATCTGCTTGATATGATTGCTCGAGCAATCATATCAAGCAGATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417713    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198562.2-1106s21c1
Sequence:CCGGGGTTGGCAGAACCTGAATTACCTCGAGGTAATTCAGGTTCTGCCAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198562.1-772s1c1
Sequence:CCGGGATTCACCCTTCAAAGAGGAACTCGAGTTCCTCTTTGAAGGGTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198562.1-594s1c1
Sequence:CCGGGAAAGATATGGAGAGAGATTTCTCGAGAAATCTCTCTCCATATCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198562.1-886s1c1
Sequence:CCGGGAGACTGTTCTGGACTTGGAACTCGAGTTCCAAGTCCAGAACAGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172631    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198562.1-2133s1c1
Sequence:CCGGGCCCGAACAAACCAAAGAGTTCTCGAGAACTCTTTGGTTTGTTCGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)