EMAIL THIS PAGE TO A FRIEND

C3orf65

chromosome 3 open reading frame 65

86 Gene Product Result for
Species: Human C3orf65(646600)
UniProtKB ID: Q96M15
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039788 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039788 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039788 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021401 MISSION® esiRNA esiRNA human C3orf65 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039788 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101325 predicted 628
2 SASI_Hs01_00101327 predicted 423
3 SASI_Hs01_00101328 predicted 806
4 SASI_Hs01_00101329 predicted 834
5 SASI_Hs02_00308674 predicted 328
6 SASI_Hs01_00101330 predicted 206
7 SASI_Hs01_00101331 predicted 335
8 SASI_Hs01_00101332 predicted 725
9 SASI_Hs01_00101333 predicted 338
10 SASI_Hs01_00101334 predicted 533
11 SASI_Hs01_00101326 predicted 222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039788
C3orf65 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 65
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039788.1-333s21c1
Sequence:CCGGACGTCCTCAGTAAGGAATTTACTCGAGTAAATTCCTTACTGAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039788.1-536s21c1
Sequence:CCGGGGTCATGCCTGGTTAACATTTCTCGAGAAATGTTAACCAGGCATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039788.1-736s21c1
Sequence:CCGGATGCTCAATGGATGACTATAACTCGAGTTATAGTCATCCATTGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039788.1-230s21c1
Sequence:CCGGTATGTCTCTGCTAACAATAAACTCGAGTTTATTGTTAGCAGAGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039788.1-425s21c1
Sequence:CCGGTGGTTAAGGAGAGTGTATTTACTCGAGTAAATACACTCTCCTTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039788
C3orf65 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 65
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039788.1-333s21c1
Sequence:CCGGACGTCCTCAGTAAGGAATTTACTCGAGTAAATTCCTTACTGAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039788.1-536s21c1
Sequence:CCGGGGTCATGCCTGGTTAACATTTCTCGAGAAATGTTAACCAGGCATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039788.1-736s21c1
Sequence:CCGGATGCTCAATGGATGACTATAACTCGAGTTATAGTCATCCATTGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039788.1-230s21c1
Sequence:CCGGTATGTCTCTGCTAACAATAAACTCGAGTTTATTGTTAGCAGAGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039788.1-425s21c1
Sequence:CCGGTGGTTAAGGAGAGTGTATTTACTCGAGTAAATACACTCTCCTTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039788
C3orf65 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 65
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039788.1-333s21c1
Sequence:CCGGACGTCCTCAGTAAGGAATTTACTCGAGTAAATTCCTTACTGAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039788.1-536s21c1
Sequence:CCGGGGTCATGCCTGGTTAACATTTCTCGAGAAATGTTAACCAGGCATGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269400    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039788.1-736s21c1
Sequence:CCGGATGCTCAATGGATGACTATAACTCGAGTTATAGTCATCCATTGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039788.1-230s21c1
Sequence:CCGGTATGTCTCTGCTAACAATAAACTCGAGTTTATTGTTAGCAGAGACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039788.1-425s21c1
Sequence:CCGGTGGTTAAGGAGAGTGTATTTACTCGAGTAAATACACTCTCCTTAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks