EMAIL THIS PAGE TO A FRIEND

C3orf67

chromosome 3 open reading frame 67

162 Gene Product Result for
Species: Human C3orf67(200844)
UniProtKB ID: Q6ZVT6, B9EKV6, Q6ZV69
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198463 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029351 MISSION® esiRNA esiRNA human C3orf67 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198463 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226415 predicted 432
2 SASI_Hs01_00226416 predicted 1112
3 SASI_Hs01_00226417 predicted 614
4 SASI_Hs02_00371989 predicted 880
5 SASI_Hs01_00226418 predicted 487
6 SASI_Hs02_00371990 predicted 734
7 SASI_Hs01_00226420 predicted 937
8 SASI_Hs01_00226421 predicted 567
9 SASI_Hs01_00226423 predicted 437
10 SASI_Hs02_00371991 predicted 760
11 SASI_Hs01_00226414 predicted 2020
12 SASI_Hs01_00226419 predicted 1663
13 SASI_Hs01_00226422 predicted 2168
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198463
C3orf67 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 67
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198463.2-532s21c1
Sequence:CCGGACGGAAGATCTTCACCTTAAACTCGAGTTTAAGGTGAAGATCTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198463.2-611s21c1
Sequence:CCGGGATGAGCCTACAGATATTATACTCGAGTATAATATCTGTAGGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198463.2-2148s21c1
Sequence:CCGGTAGCAGTTCAGGGTCGCTTAACTCGAGTTAAGCGACCCTGAACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198463.2-800s21c1
Sequence:CCGGGATGTTTGTCATATCGCATTTCTCGAGAAATGCGATATGACAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198463.1-1170s1c1
Sequence:CCGGCGGTAGCTCTTCAGGAAATAACTCGAGTTATTTCCTGAAGAGCTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198463.1-1116s1c1
Sequence:CCGGCAGAAGAAGATTACGGTTAAACTCGAGTTTAACCGTAATCTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198463.1-743s1c1
Sequence:CCGGCAGAATCAGATCAGTTCATTACTCGAGTAATGAACTGATCTGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198463.1-2046s1c1
Sequence:CCGGCCCTTGTCTGAACTGTTACTTCTCGAGAAGTAACAGTTCAGACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198463.1-1285s1c1
Sequence:CCGGGATCAATCAGATGAGTGGATTCTCGAGAATCCACTCATCTGATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198463.1-2249s1c1
Sequence:CCGGGTTCAACGTTAAGAATACCTACTCGAGTAGGTATTCTTAACGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167623    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198463.1-2334s1c1
Sequence:CCGGGAGTTTGAATTGGTTCTTGTTCTCGAGAACAAGAACCAATTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198463
C3orf67 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 67
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198463.2-532s21c1
Sequence:CCGGACGGAAGATCTTCACCTTAAACTCGAGTTTAAGGTGAAGATCTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198463.2-611s21c1
Sequence:CCGGGATGAGCCTACAGATATTATACTCGAGTATAATATCTGTAGGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198463.2-2148s21c1
Sequence:CCGGTAGCAGTTCAGGGTCGCTTAACTCGAGTTAAGCGACCCTGAACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198463.2-800s21c1
Sequence:CCGGGATGTTTGTCATATCGCATTTCTCGAGAAATGCGATATGACAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198463.1-1170s1c1
Sequence:CCGGCGGTAGCTCTTCAGGAAATAACTCGAGTTATTTCCTGAAGAGCTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198463.1-1116s1c1
Sequence:CCGGCAGAAGAAGATTACGGTTAAACTCGAGTTTAACCGTAATCTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198463.1-743s1c1
Sequence:CCGGCAGAATCAGATCAGTTCATTACTCGAGTAATGAACTGATCTGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198463.1-2046s1c1
Sequence:CCGGCCCTTGTCTGAACTGTTACTTCTCGAGAAGTAACAGTTCAGACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198463.1-1285s1c1
Sequence:CCGGGATCAATCAGATGAGTGGATTCTCGAGAATCCACTCATCTGATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198463.1-2249s1c1
Sequence:CCGGGTTCAACGTTAAGAATACCTACTCGAGTAGGTATTCTTAACGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167623    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198463.1-2334s1c1
Sequence:CCGGGAGTTTGAATTGGTTCTTGTTCTCGAGAACAAGAACCAATTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198463
C3orf67 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 67
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198463.2-532s21c1
Sequence:CCGGACGGAAGATCTTCACCTTAAACTCGAGTTTAAGGTGAAGATCTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198463.2-611s21c1
Sequence:CCGGGATGAGCCTACAGATATTATACTCGAGTATAATATCTGTAGGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198463.2-2148s21c1
Sequence:CCGGTAGCAGTTCAGGGTCGCTTAACTCGAGTTAAGCGACCCTGAACTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198463.2-800s21c1
Sequence:CCGGGATGTTTGTCATATCGCATTTCTCGAGAAATGCGATATGACAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198463.1-1170s1c1
Sequence:CCGGCGGTAGCTCTTCAGGAAATAACTCGAGTTATTTCCTGAAGAGCTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167352    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198463.1-1116s1c1
Sequence:CCGGCAGAAGAAGATTACGGTTAAACTCGAGTTTAACCGTAATCTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198463.1-743s1c1
Sequence:CCGGCAGAATCAGATCAGTTCATTACTCGAGTAATGAACTGATCTGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198463.1-2046s1c1
Sequence:CCGGCCCTTGTCTGAACTGTTACTTCTCGAGAAGTAACAGTTCAGACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198463.1-1285s1c1
Sequence:CCGGGATCAATCAGATGAGTGGATTCTCGAGAATCCACTCATCTGATTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167486    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198463.1-2249s1c1
Sequence:CCGGGTTCAACGTTAAGAATACCTACTCGAGTAGGTATTCTTAACGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167623    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198463.1-2334s1c1
Sequence:CCGGGAGTTTGAATTGGTTCTTGTTCTCGAGAACAAGAACCAATTCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks