EMAIL THIS PAGE TO A FRIEND

C3orf70

chromosome 3 open reading frame 70

18 Gene Product Result for
Species: Human C3orf70(285382)
UniProtKB ID: A6NLC5, B2RNY2, B9EH83
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025266 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025266 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025266 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155211 MISSION® esiRNA esiRNA human C3orf70 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025266 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025266 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212581 predicted 907
2 SASI_Hs01_00212582 predicted 1064
3 SASI_Hs01_00212583 predicted 1227
4 SASI_Hs02_00307435 predicted 586
5 SASI_Hs01_00212584 predicted 1224
6 SASI_Hs01_00212585 predicted 993
7 SASI_Hs01_00212586 predicted 1097
8 SASI_Hs01_00212587 predicted 1078
9 SASI_Hs01_00212588 predicted 1144
10 SASI_Hs01_00212589 predicted 554
11 SASI_Hs01_00212590 predicted 1204
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025266
C3orf70 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 70
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025266.1-912s1c1
Sequence:CCGGGAAGTGATTGAAACGATAGAACTCGAGTTCTATCGTTTCAATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025266.1-1090s21c1
Sequence:CCGGATTAGCTTCTCTCCGTCTTACCTCGAGGTAAGACGGAGAGAAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-751s21c1
Sequence:CCGGCTGAGGACTCTGGGATCAATGCTCGAGCATTGATCCCAGAGTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-914s21c1
Sequence:CCGGAGTGATTGAAACGATAGAAACCTCGAGGTTTCTATCGTTTCAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-606s21c1
Sequence:CCGGATTAATGGGAAGATGTGTTATCTCGAGATAACACATCTTCCCATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-678s21c1
Sequence:CCGGTCTGCACACGATGCCTTAATTCTCGAGAATTAAGGCATCGTGTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025266.1-3737s21c1
Sequence:CCGGCTTGCTACTATCTACTATATACTCGAGTATATAGTAGATAGTAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-550s21c1
Sequence:CCGGCACCGAGGTACTGTATGATTTCTCGAGAAATCATACAGTACCTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-583s21c1
Sequence:CCGGTTGACAACTATCAGGTTAAATCTCGAGATTTAACCTGATAGTTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025266
C3orf70 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 70
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025266.1-912s1c1
Sequence:CCGGGAAGTGATTGAAACGATAGAACTCGAGTTCTATCGTTTCAATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025266.1-1090s21c1
Sequence:CCGGATTAGCTTCTCTCCGTCTTACCTCGAGGTAAGACGGAGAGAAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-751s21c1
Sequence:CCGGCTGAGGACTCTGGGATCAATGCTCGAGCATTGATCCCAGAGTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-914s21c1
Sequence:CCGGAGTGATTGAAACGATAGAAACCTCGAGGTTTCTATCGTTTCAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-606s21c1
Sequence:CCGGATTAATGGGAAGATGTGTTATCTCGAGATAACACATCTTCCCATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-678s21c1
Sequence:CCGGTCTGCACACGATGCCTTAATTCTCGAGAATTAAGGCATCGTGTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025266.1-3737s21c1
Sequence:CCGGCTTGCTACTATCTACTATATACTCGAGTATATAGTAGATAGTAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-550s21c1
Sequence:CCGGCACCGAGGTACTGTATGATTTCTCGAGAAATCATACAGTACCTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-583s21c1
Sequence:CCGGTTGACAACTATCAGGTTAAATCTCGAGATTTAACCTGATAGTTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025266
C3orf70 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 70
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025266.1-912s1c1
Sequence:CCGGGAAGTGATTGAAACGATAGAACTCGAGTTCTATCGTTTCAATCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025266.1-1090s21c1
Sequence:CCGGATTAGCTTCTCTCCGTCTTACCTCGAGGTAAGACGGAGAGAAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-751s21c1
Sequence:CCGGCTGAGGACTCTGGGATCAATGCTCGAGCATTGATCCCAGAGTCCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-914s21c1
Sequence:CCGGAGTGATTGAAACGATAGAAACCTCGAGGTTTCTATCGTTTCAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-606s21c1
Sequence:CCGGATTAATGGGAAGATGTGTTATCTCGAGATAACACATCTTCCCATTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-678s21c1
Sequence:CCGGTCTGCACACGATGCCTTAATTCTCGAGAATTAAGGCATCGTGTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025266.1-3737s21c1
Sequence:CCGGCTTGCTACTATCTACTATATACTCGAGTATATAGTAGATAGTAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-550s21c1
Sequence:CCGGCACCGAGGTACTGTATGATTTCTCGAGAAATCATACAGTACCTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025266.1-583s21c1
Sequence:CCGGTTGACAACTATCAGGTTAAATCTCGAGATTTAACCTGATAGTTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks