EMAIL THIS PAGE TO A FRIEND

C3orf72

chromosome 3 open reading frame 72

28 Gene Product Result for
Species: Human C3orf72(401089)
UniProtKB ID: Q6ZUU3, A6NGX0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040061 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102561 MISSION® esiRNA esiRNA human AC116904.7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040061 Rosetta Predictions human pricing
XM_376269 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308785 predicted 631
2 SASI_Hs02_00308786 predicted 977
3 SASI_Hs02_00308787 predicted 854
4 SASI_Hs02_00308788 predicted 633
5 SASI_Hs02_00308789 predicted 855
6 SASI_Hs02_00308790 predicted 676
7 SASI_Hs02_00308791 predicted 852
8 SASI_Hs02_00308792 predicted 901
9 SASI_Hs02_00308793 predicted 862
10 SASI_Hs02_00308794 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273829 predicted 630
2 SASI_Hs01_00273830 predicted 973
3 SASI_Hs01_00273831 predicted 853
4 SASI_Hs01_00273832 predicted 855
5 SASI_Hs01_00273833 predicted 676
6 SASI_Hs01_00273834 predicted 846
7 SASI_Hs01_00273835 predicted 562
8 SASI_Hs01_00273836 predicted 907
9 SASI_Hs01_00273837 predicted 869
10 SASI_Hs01_00273838 predicted 1007
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040061
C3orf72 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 72
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040061.1-616s21c1
Sequence:CCGGTGCGGTGCTTGGCTAGCAAAGCTCGAGCTTTGCTAGCCAAGCACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040061.1-3862s21c1
Sequence:CCGGTCGTATAAATGGAGCATATAGCTCGAGCTATATGCTCCATTTATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040061.1-638s21c1
Sequence:CCGGGAAGCTTCACTGTGTCTATTACTCGAGTAATAGACACAGTGAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040061.1-313s21c1
Sequence:CCGGTTCACATGGCTGTCCGGCATTCTCGAGAATGCCGGACAGCCATGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040061.1-565s21c1
Sequence:CCGGAGCGGGAGAGAATAGAGCTTGCTCGAGCAAGCTCTATTCTCTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040061
C3orf72 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 72
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040061.1-616s21c1
Sequence:CCGGTGCGGTGCTTGGCTAGCAAAGCTCGAGCTTTGCTAGCCAAGCACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040061.1-3862s21c1
Sequence:CCGGTCGTATAAATGGAGCATATAGCTCGAGCTATATGCTCCATTTATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040061.1-638s21c1
Sequence:CCGGGAAGCTTCACTGTGTCTATTACTCGAGTAATAGACACAGTGAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040061.1-313s21c1
Sequence:CCGGTTCACATGGCTGTCCGGCATTCTCGAGAATGCCGGACAGCCATGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040061.1-565s21c1
Sequence:CCGGAGCGGGAGAGAATAGAGCTTGCTCGAGCAAGCTCTATTCTCTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040061
C3orf72 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 72
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040061.1-616s21c1
Sequence:CCGGTGCGGTGCTTGGCTAGCAAAGCTCGAGCTTTGCTAGCCAAGCACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040061.1-3862s21c1
Sequence:CCGGTCGTATAAATGGAGCATATAGCTCGAGCTATATGCTCCATTTATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040061.1-638s21c1
Sequence:CCGGGAAGCTTCACTGTGTCTATTACTCGAGTAATAGACACAGTGAAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040061.1-313s21c1
Sequence:CCGGTTCACATGGCTGTCCGGCATTCTCGAGAATGCCGGACAGCCATGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040061.1-565s21c1
Sequence:CCGGAGCGGGAGAGAATAGAGCTTGCTCGAGCAAGCTCTATTCTCTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks