EMAIL THIS PAGE TO A FRIEND

C3orf79

chromosome 3 open reading frame 79

25 Gene Product Result for
Species: Human C3orf79(152118)
UniProtKB ID: P0CE67
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101337 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101337 Rosetta Predictions human pricing
XM_098163 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322625 predicted 200
2 SASI_Hs02_00322626 predicted 228
3 SASI_Hs02_00322627 predicted 226
4 SASI_Hs02_00322628 predicted 323
5 SASI_Hs02_00322629 predicted 317
6 SASI_Hs02_00322630 predicted 314
7 SASI_Hs02_00322631 predicted 231
8 SASI_Hs02_00322632 predicted 325
9 SASI_Hs02_00322633 predicted 283
10 SASI_Hs02_00322634 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_098163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265456 predicted 346
2 SASI_Hs01_00265457 predicted 340
3 SASI_Hs01_00265458 predicted 228
4 SASI_Hs01_00265459 predicted 343
5 SASI_Hs01_00265460 predicted 345
6 SASI_Hs01_00265461 predicted 231
7 SASI_Hs01_00265462 predicted 333
8 SASI_Hs01_00265463 predicted 224
9 SASI_Hs01_00265464 predicted 321
10 SASI_Hs01_00265465 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101337
C3orf79 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 79
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101337.1-293s21c1
Sequence:CCGGGATTCAAGGAGGAACTGAAATCTCGAGATTTCAGTTCCTCCTTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101337.1-205s21c1
Sequence:CCGGGTCTAACCCAAATGCCAATTTCTCGAGAAATTGGCATTTGGGTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101337.1-326s21c1
Sequence:CCGGCTTTGCAAACCAGTATCAAACCTCGAGGTTTGATACTGGTTTGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101337.1-233s21c1
Sequence:CCGGGCACCCTGCCACTCTTCTAAACTCGAGTTTAGAAGAGTGGCAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101337.1-374s21c1
Sequence:CCGGCTACCATTGGAATAACATAATCTCGAGATTATGTTATTCCAATGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101337
C3orf79 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 79
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101337.1-293s21c1
Sequence:CCGGGATTCAAGGAGGAACTGAAATCTCGAGATTTCAGTTCCTCCTTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101337.1-205s21c1
Sequence:CCGGGTCTAACCCAAATGCCAATTTCTCGAGAAATTGGCATTTGGGTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101337.1-326s21c1
Sequence:CCGGCTTTGCAAACCAGTATCAAACCTCGAGGTTTGATACTGGTTTGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101337.1-233s21c1
Sequence:CCGGGCACCCTGCCACTCTTCTAAACTCGAGTTTAGAAGAGTGGCAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101337.1-374s21c1
Sequence:CCGGCTACCATTGGAATAACATAATCTCGAGATTATGTTATTCCAATGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101337
C3orf79 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 79
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101337.1-293s21c1
Sequence:CCGGGATTCAAGGAGGAACTGAAATCTCGAGATTTCAGTTCCTCCTTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101337.1-205s21c1
Sequence:CCGGGTCTAACCCAAATGCCAATTTCTCGAGAAATTGGCATTTGGGTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101337.1-326s21c1
Sequence:CCGGCTTTGCAAACCAGTATCAAACCTCGAGGTTTGATACTGGTTTGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101337.1-233s21c1
Sequence:CCGGGCACCCTGCCACTCTTCTAAACTCGAGTTTAGAAGAGTGGCAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101337.1-374s21c1
Sequence:CCGGCTACCATTGGAATAACATAATCTCGAGATTATGTTATTCCAATGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks