EMAIL THIS PAGE TO A FRIEND

C3orf80

chromosome 3 open reading frame 80

44 Gene Product Result for
Species: Human C3orf80(401097)
UniProtKB ID: F5H4A9, Q8N5S4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001168214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001168214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001168214 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717103 Rosetta Predictions human pricing
XM_001718562 Rosetta Predictions human pricing
XM_001718743 Rosetta Predictions human pricing
XM_376281 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00415008 predicted 245
2 SASI_Hs02_00415009 predicted 273
3 SASI_Hs02_00415010 predicted 250
4 SASI_Hs02_00415011 predicted 247
5 SASI_Hs02_00415012 predicted 275
6 SASI_Hs02_00415013 predicted 243
7 SASI_Hs02_00415014 predicted 245
8 SASI_Hs02_00415015 predicted 246
9 SASI_Hs02_00415016 predicted 257
10 SASI_Hs02_00415017 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00424798 predicted 1137
2 SASI_Hs02_00424799 predicted 1153
3 SASI_Hs02_00424800 predicted 997
4 SASI_Hs02_00424801 predicted 1189
5 SASI_Hs02_00424802 predicted 388
6 SASI_Hs02_00424803 predicted 649
7 SASI_Hs02_00424804 predicted 93
8 SASI_Hs02_00424805 predicted 686
9 SASI_Hs02_00424806 predicted 1216
10 SASI_Hs02_00424807 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00426012 predicted 1133
2 SASI_Hs02_00426013 predicted 1155
3 SASI_Hs02_00426014 predicted 999
4 SASI_Hs02_00426015 predicted 1193
5 SASI_Hs02_00426016 predicted 385
6 SASI_Hs02_00426017 predicted 652
7 SASI_Hs02_00426018 predicted 92
8 SASI_Hs02_00426019 predicted 691
9 SASI_Hs02_00426020 predicted 1217
10 SASI_Hs02_00426021 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284989 predicted 938
2 SASI_Hs01_00284990 predicted 763
3 SASI_Hs01_00284991 predicted 761
4 SASI_Hs01_00284992 predicted 942
5 SASI_Hs01_00284993 predicted 945
6 SASI_Hs01_00284994 predicted 769
7 SASI_Hs01_00284995 predicted 761
8 SASI_Hs01_00284996 predicted 933
9 SASI_Hs01_00284997 predicted 931
10 SASI_Hs01_00284998 predicted 949
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001168214
C3orf80 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 80
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-1113s21c1
Sequence:CCGGTCTTCTTTAGGGCTGAGGAGACTCGAGTCTCCTCAGCCCTAAAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168214.1-284s21c1
Sequence:CCGGGCTATTTCCTGCAGCGCATCACTCGAGTGATGCGCTGCAGGAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-814s21c1
Sequence:CCGGGCCAACTGCCTCAGACCTTATCTCGAGATAAGGTCTGAGGCAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-1072s21c1
Sequence:CCGGAGAGAACACGTGAGCCCTTTGCTCGAGCAAAGGGCTCACGTGTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-923s21c1
Sequence:CCGGTGCGTTTCATTCCGTTCAAAGCTCGAGCTTTGAACGGAATGAAACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-1018s21c1
Sequence:CCGGCTCTGCCTTGCCTCGTATTGTCTCGAGACAATACGAGGCAAGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-1055s21c1
Sequence:CCGCCCTGCTTCCCTAGTCAAAGAGCTCGAGCTCTTTGACTAGGGAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168214.1-537s21c1
Sequence:CCGGAGAGCACGAGATGCGTGTAGTCTCGAGACTACACGCATCTCGTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168214.1-724s21c1
Sequence:CCGGGGCCGCTACCCTCTTATCTGACTCGAGTCAGATAAGAGGGTAGCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001168214
C3orf80 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 80
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-1113s21c1
Sequence:CCGGTCTTCTTTAGGGCTGAGGAGACTCGAGTCTCCTCAGCCCTAAAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168214.1-284s21c1
Sequence:CCGGGCTATTTCCTGCAGCGCATCACTCGAGTGATGCGCTGCAGGAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-814s21c1
Sequence:CCGGGCCAACTGCCTCAGACCTTATCTCGAGATAAGGTCTGAGGCAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-1072s21c1
Sequence:CCGGAGAGAACACGTGAGCCCTTTGCTCGAGCAAAGGGCTCACGTGTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-923s21c1
Sequence:CCGGTGCGTTTCATTCCGTTCAAAGCTCGAGCTTTGAACGGAATGAAACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-1018s21c1
Sequence:CCGGCTCTGCCTTGCCTCGTATTGTCTCGAGACAATACGAGGCAAGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-1055s21c1
Sequence:CCGCCCTGCTTCCCTAGTCAAAGAGCTCGAGCTCTTTGACTAGGGAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168214.1-537s21c1
Sequence:CCGGAGAGCACGAGATGCGTGTAGTCTCGAGACTACACGCATCTCGTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168214.1-724s21c1
Sequence:CCGGGGCCGCTACCCTCTTATCTGACTCGAGTCAGATAAGAGGGTAGCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001168214
C3orf80 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 80
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-1113s21c1
Sequence:CCGGTCTTCTTTAGGGCTGAGGAGACTCGAGTCTCCTCAGCCCTAAAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168214.1-284s21c1
Sequence:CCGGGCTATTTCCTGCAGCGCATCACTCGAGTGATGCGCTGCAGGAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419036    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-814s21c1
Sequence:CCGGGCCAACTGCCTCAGACCTTATCTCGAGATAAGGTCTGAGGCAGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-1072s21c1
Sequence:CCGGAGAGAACACGTGAGCCCTTTGCTCGAGCAAAGGGCTCACGTGTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-923s21c1
Sequence:CCGGTGCGTTTCATTCCGTTCAAAGCTCGAGCTTTGAACGGAATGAAACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-1018s21c1
Sequence:CCGGCTCTGCCTTGCCTCGTATTGTCTCGAGACAATACGAGGCAAGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001168214.1-1055s21c1
Sequence:CCGCCCTGCTTCCCTAGTCAAAGAGCTCGAGCTCTTTGACTAGGGAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168214.1-537s21c1
Sequence:CCGGAGAGCACGAGATGCGTGTAGTCTCGAGACTACACGCATCTCGTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001168214.1-724s21c1
Sequence:CCGGGGCCGCTACCCTCTTATCTGACTCGAGTCAGATAAGAGGGTAGCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks