EMAIL THIS PAGE TO A FRIEND

C3orf84

chromosome 3 open reading frame 84

22 Gene Product Result for
Species: Human C3orf84(646498)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080528 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080528 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080528 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080528 Rosetta Predictions human pricing
XM_929422 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080528 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315717 predicted 395
2 SASI_Hs02_00315718 predicted 281
3 SASI_Hs02_00315719 predicted 282
4 SASI_Hs02_00315720 predicted 321
5 SASI_Hs02_00315721 predicted 320
6 SASI_Hs02_00315722 predicted 208
7 SASI_Hs02_00315723 predicted 201
8 SASI_Hs02_00315724 predicted 271
9 SASI_Hs02_00315725 predicted 201
10 SASI_Hs02_00315726 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281607 predicted 396
2 SASI_Hs01_00281608 predicted 286
3 SASI_Hs01_00281609 predicted 286
4 SASI_Hs01_00281610 predicted 276
5 SASI_Hs01_00281611 predicted 331
6 SASI_Hs01_00281612 predicted 321
7 SASI_Hs01_00281613 predicted 207
8 SASI_Hs01_00281614 predicted 278
9 SASI_Hs01_00281615 predicted 202
10 SASI_Hs01_00281616 predicted 207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080528
C3orf84 MISSION shRNA Bacterial Glycerol Stock
chromosome 3 open reading frame 84
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080528.1-327s21c1
Sequence:CCGGATCTTCTTACCAGGCTGATTTCTCGAGAAATCAGCCTGGTAAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080528.1-72s21c1
Sequence:CCGGCTATCCCTGGGACAGGCTTTACTCGAGTAAAGCCTGTCCCAGGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080528.1-285s21c1
Sequence:CCGGGGCACCCTGTGAGATAGAGTTCTCGAGAACTCTATCTCACAGGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080528.1-170s21c1
Sequence:CCGGCCAAGCACGACAACCGTACTTCTCGAGAAGTACGGTTGTCGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080528.1-195s21c1
Sequence:CCGGTGACAAAGAGGGTCCCTATTGCTCGAGCAATAGGGACCCTCTTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080528
C3orf84 MISSION shRNA shRNA Plasmid DNA
chromosome 3 open reading frame 84
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080528.1-327s21c1
Sequence:CCGGATCTTCTTACCAGGCTGATTTCTCGAGAAATCAGCCTGGTAAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080528.1-72s21c1
Sequence:CCGGCTATCCCTGGGACAGGCTTTACTCGAGTAAAGCCTGTCCCAGGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080528.1-285s21c1
Sequence:CCGGGGCACCCTGTGAGATAGAGTTCTCGAGAACTCTATCTCACAGGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080528.1-170s21c1
Sequence:CCGGCCAAGCACGACAACCGTACTTCTCGAGAAGTACGGTTGTCGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080528.1-195s21c1
Sequence:CCGGTGACAAAGAGGGTCCCTATTGCTCGAGCAATAGGGACCCTCTTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080528
C3orf84 MISSION shRNA Lentiviral Transduction Particles
chromosome 3 open reading frame 84
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080528.1-327s21c1
Sequence:CCGGATCTTCTTACCAGGCTGATTTCTCGAGAAATCAGCCTGGTAAGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080528.1-72s21c1
Sequence:CCGGCTATCCCTGGGACAGGCTTTACTCGAGTAAAGCCTGTCCCAGGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080528.1-285s21c1
Sequence:CCGGGGCACCCTGTGAGATAGAGTTCTCGAGAACTCTATCTCACAGGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080528.1-170s21c1
Sequence:CCGGCCAAGCACGACAACCGTACTTCTCGAGAAGTACGGTTGTCGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080528.1-195s21c1
Sequence:CCGGTGACAAAGAGGGTCCCTATTGCTCGAGCAATAGGGACCCTCTTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks