EMAIL THIS PAGE TO A FRIEND

C4A

complement component 4A (Rodgers blood group)

Synonyms: C4 C4A2 C4A3 C4A4 C4A6 C4AD C4S CO4 CPAMD2 RG
Gene ID:
Human(720) Summary: This gene encodes the acidic form of complement factor 4, part of the classical activation pathway. The protein is expressed as a single chain precursor which is proteolytically cleaved into a trimer of alpha, beta, and gamma chains prior to secretion. The trimer provides a surface for interaction between the antigen-antibody complex and other complement components. The alpha chain may be cleaved to release C4 anaphylatoxin, a mediator of local inflammation. Deficiency of this protein is associated with systemic lupus erythematosus and type I diabetes mellitus. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. Varying haplotypes of this gene cluster exist, such that individuals may have 1, 2, or 3 copies of this gene. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(625018) complement component 4A (Rodgers blood group)
Rat(24233) complement component 4A (Rodgers blood group)
dog(481722) complement component 4A (Rodgers blood group)
Horse(100059239) complement component 4A (Rodgers blood group)
cow(280678) complement component 4A
naked mole-rat(101719002) complement component 4A (Rodgers blood group)
domestic guinea pig(100728345) complement component 4A (Rodgers blood group)
sheep(101123672) complement component 4A (Rodgers blood group)
Domestic Rabbit(100356976) complement component 4A (Rodgers blood group)
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2700077 Anti-C4A (N-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing

Proteins

Product # Description Species Add to Cart
 
C8195 Complement C4 from human serum ≥300,000 C4H50 units/mg protein human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007293 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011413 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011413 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011413 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU095541 MISSION® esiRNA esiRNA targeting mouse C4a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007293 Rosetta Predictions human pricing
NM_031504 Rosetta Predictions rat pricing
NM_011413 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118018 predicted 1901
2 SASI_Hs01_00118019 predicted 273
3 SASI_Hs01_00118020 predicted 5007
4 SASI_Hs01_00118021 predicted 2987
5 SASI_Hs01_00118022 predicted 685
6 SASI_Hs01_00118024 predicted 5162
7 SASI_Hs01_00118025 predicted 4302
8 SASI_Hs01_00118026 predicted 4929
9 SASI_Hs01_00118027 predicted 4966
10 SASI_Hs02_00343363 predicted 418
11 SASI_Hs01_00118023 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030288 predicted 1316
2 SASI_Rn01_00030289 predicted 5091
3 SASI_Rn01_00030290 predicted 3408
4 SASI_Rn02_00264627 predicted 2754
5 SASI_Rn01_00030291 predicted 4843
6 SASI_Rn01_00030293 predicted 2527
7 SASI_Rn01_00030294 predicted 4855
8 SASI_Rn01_00030295 predicted 824
9 SASI_Rn01_00030297 predicted 411
10 SASI_Rn02_00264628 predicted 2068
11 SASI_Rn01_00030292 predicted 1972
12 SASI_Rn01_00030296 predicted 4664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011413 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320624 predicted 1758
2 SASI_Mm01_00074535 predicted 2799
3 SASI_Mm02_00320625 predicted 1496
4 SASI_Mm02_00320626 predicted 4297
5 SASI_Mm02_00320627 predicted 2939
6 SASI_Mm02_00320628 predicted 2772
7 SASI_Mm02_00320629 predicted 1236
8 SASI_Mm02_00320630 predicted 2690
9 SASI_Mm02_00320631 predicted 2772
10 SASI_Mm02_00320632 predicted 4868
11 SASI_Mm01_00074532 predicted 4891
12 SASI_Mm01_00074533 predicted 2815
13 SASI_Mm01_00074534 predicted 1113
14 SASI_Mm01_00074536 predicted 4546
15 SASI_Mm01_00074537 predicted 601
16 SASI_Mm01_00074538 predicted 3109
17 SASI_Mm01_00074539 predicted 752
18 SASI_Mm01_00074540 predicted 2602
19 SASI_Mm01_00074541 predicted 1545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007293
C4A MISSION shRNA Bacterial Glycerol Stock
complement component 4A (Rodgers blood group)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007293.1-5069s1c1
Sequence:CCGGGCTTGGAACCTGGGAAAGAATCTCGAGATTCTTTCCCAGGTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007293.1-222s1c1
Sequence:CCGGCCTGAGAAACCCATCTCGTAACTCGAGTTACGAGATGGGTTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007293.1-906s1c1
Sequence:CCGGGCTCCTAGATGAGGATGGTAACTCGAGTTACCATCCTCATCTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007293.1-79s1c1
Sequence:CCGGGCATCCAGCTTCTTCACCTTACTCGAGTAAGGTGAAGAAGCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007293.1-4995s1c1
Sequence:CCGGGCACTTCACCAAGGATGTCAACTCGAGTTGACATCCTTGGTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007293.2-4133s21c1
Sequence:CCGGCCTTGGGCAGCAAGATCAATGCTCGAGCATTGATCTTGCTGCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007293.2-4085s21c1
Sequence:CCGGAGCTGAACAACCGCCAGATTCCTCGAGGAATCTGGCGGTTGTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007293.2-5150s21c1
Sequence:CCGGAGTACCTGCTGGACTCGAATACTCGAGTATTCGAGTCCAGCAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007293.2-4187s21c1
Sequence:CCGGAGGTCCTTCGTACCTACAATGCTCGAGCATTGTAGGTACGAAGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007293
C4A MISSION shRNA shRNA Plasmid DNA
complement component 4A (Rodgers blood group)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007293.1-5069s1c1
Sequence:CCGGGCTTGGAACCTGGGAAAGAATCTCGAGATTCTTTCCCAGGTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007293.1-222s1c1
Sequence:CCGGCCTGAGAAACCCATCTCGTAACTCGAGTTACGAGATGGGTTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007293.1-906s1c1
Sequence:CCGGGCTCCTAGATGAGGATGGTAACTCGAGTTACCATCCTCATCTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007293.1-79s1c1
Sequence:CCGGGCATCCAGCTTCTTCACCTTACTCGAGTAAGGTGAAGAAGCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007293.1-4995s1c1
Sequence:CCGGGCACTTCACCAAGGATGTCAACTCGAGTTGACATCCTTGGTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007293.2-4133s21c1
Sequence:CCGGCCTTGGGCAGCAAGATCAATGCTCGAGCATTGATCTTGCTGCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007293.2-4085s21c1
Sequence:CCGGAGCTGAACAACCGCCAGATTCCTCGAGGAATCTGGCGGTTGTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007293.2-5150s21c1
Sequence:CCGGAGTACCTGCTGGACTCGAATACTCGAGTATTCGAGTCCAGCAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007293.2-4187s21c1
Sequence:CCGGAGGTCCTTCGTACCTACAATGCTCGAGCATTGTAGGTACGAAGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007293
C4A MISSION shRNA Lentiviral Transduction Particles
complement component 4A (Rodgers blood group)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007293.1-5069s1c1
Sequence:CCGGGCTTGGAACCTGGGAAAGAATCTCGAGATTCTTTCCCAGGTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007293.1-222s1c1
Sequence:CCGGCCTGAGAAACCCATCTCGTAACTCGAGTTACGAGATGGGTTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007293.1-906s1c1
Sequence:CCGGGCTCCTAGATGAGGATGGTAACTCGAGTTACCATCCTCATCTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007293.1-79s1c1
Sequence:CCGGGCATCCAGCTTCTTCACCTTACTCGAGTAAGGTGAAGAAGCTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007293.1-4995s1c1
Sequence:CCGGGCACTTCACCAAGGATGTCAACTCGAGTTGACATCCTTGGTGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007293.2-4133s21c1
Sequence:CCGGCCTTGGGCAGCAAGATCAATGCTCGAGCATTGATCTTGCTGCCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007293.2-4085s21c1
Sequence:CCGGAGCTGAACAACCGCCAGATTCCTCGAGGAATCTGGCGGTTGTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007293.2-5150s21c1
Sequence:CCGGAGTACCTGCTGGACTCGAATACTCGAGTATTCGAGTCCAGCAGGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007293.2-4187s21c1
Sequence:CCGGAGGTCCTTCGTACCTACAATGCTCGAGCATTGTAGGTACGAAGGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011413
C4A MISSION shRNA Bacterial Glycerol Stock
complement component 4A (Rodgers blood group)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011413.1-1125s1c1
Sequence:CCGGGCGCTTTGTATCATCTGCCTTCTCGAGAAGGCAGATGATACAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011413.1-2317s1c1
Sequence:CCGGCGGGACATGGTGAATTTGATACTCGAGTATCAAATTCACCATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011413.1-815s1c1
Sequence:CCGGGCAACAGTGATGAAATCCAATCTCGAGATTGGATTTCATCACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011413.1-2809s1c1
Sequence:CCGGGTGTCTAAGATTCTCCAAATTCTCGAGAATTTGGAGAATCTTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011413.1-1237s1c1
Sequence:CCGGGCCTCTAACGTTATTGTCAAACTCGAGTTTGACAATAACGTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011413
C4A MISSION shRNA shRNA Plasmid DNA
complement component 4A (Rodgers blood group)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011413.1-1125s1c1
Sequence:CCGGGCGCTTTGTATCATCTGCCTTCTCGAGAAGGCAGATGATACAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011413.1-2317s1c1
Sequence:CCGGCGGGACATGGTGAATTTGATACTCGAGTATCAAATTCACCATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011413.1-815s1c1
Sequence:CCGGGCAACAGTGATGAAATCCAATCTCGAGATTGGATTTCATCACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011413.1-2809s1c1
Sequence:CCGGGTGTCTAAGATTCTCCAAATTCTCGAGAATTTGGAGAATCTTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011413.1-1237s1c1
Sequence:CCGGGCCTCTAACGTTATTGTCAAACTCGAGTTTGACAATAACGTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011413
C4A MISSION shRNA Lentiviral Transduction Particles
complement component 4A (Rodgers blood group)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011413.1-1125s1c1
Sequence:CCGGGCGCTTTGTATCATCTGCCTTCTCGAGAAGGCAGATGATACAAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011413.1-2317s1c1
Sequence:CCGGCGGGACATGGTGAATTTGATACTCGAGTATCAAATTCACCATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011413.1-815s1c1
Sequence:CCGGGCAACAGTGATGAAATCCAATCTCGAGATTGGATTTCATCACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011413.1-2809s1c1
Sequence:CCGGGTGTCTAAGATTCTCCAAATTCTCGAGAATTTGGAGAATCTTAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011413.1-1237s1c1
Sequence:CCGGGCCTCTAACGTTATTGTCAAACTCGAGTTTGACAATAACGTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks