EMAIL THIS PAGE TO A FRIEND

C4B

complement component 4B (Chido blood group)

54 Gene Product Result for
Synonyms: C4B1 C4B12 C4B2 C4B3 C4B5 C4BD C4B_2 C4F CH CO4 CPAMD3
Gene ID:
Human(721) Summary: This gene encodes the basic form of complement factor 4, part of the classical activation pathway. The protein is expressed as a single chain precursor which is proteolytically cleaved into a trimer of alpha, beta, and gamma chains prior to secretion. The trimer provides a surface for interaction between the antigen-antibody complex and other complement components. The alpha chain may be cleaved to release C4 anaphylatoxin, a mediator of local inflammation. Deficiency of this protein is associated with systemic lupus erythematosus. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. Varying haplotypes of this gene cluster exist, such that individuals may have 1, 2, or 3 copies of this gene. In addition, this gene exists as a long form and a short form due to the presence or absence of a 6.4 kb endogenous HERV-K retrovirus in intron 9. [provided by RefSeq, Jul 2008]
Mouse(12268) complement component 4B (Chido blood group)
Rat(406161) complement component 4B (Chido blood group)
cow(100851057) complement component 4B (Chido blood group)
domestic cat(101094346) complement component 4B (Chido blood group)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000592 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000592 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000592 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009780 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009780 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009780 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001002029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002029 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU092951 MISSION® esiRNA esiRNA targeting mouse C4a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002029 Rosetta Predictions human pricing
NM_001002805 Rosetta Predictions rat pricing
NM_009780 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242081 predicted 1903
2 SASI_Hs01_00242082 predicted 277
3 SASI_Hs01_00242083 predicted 5011
4 SASI_Hs01_00242084 predicted 2986
5 SASI_Hs01_00242085 predicted 684
6 SASI_Hs01_00242087 predicted 5156
7 SASI_Hs01_00242088 predicted 4300
8 SASI_Hs01_00242089 predicted 4931
9 SASI_Hs01_00242090 predicted 4972
10 SASI_Hs02_00304092 predicted 412
11 SASI_Hs01_00242086 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056784 predicted 274
2 SASI_Rn01_00056787 predicted 769
3 SASI_Rn01_00056788 predicted 584
4 SASI_Rn01_00056790 predicted 3410
5 SASI_Rn02_00197988 predicted 2755
6 SASI_Rn01_00056791 predicted 4840
7 SASI_Rn01_00056792 predicted 325
8 SASI_Rn01_00056793 predicted 461
9 SASI_Rn02_00197989 predicted 4861
10 SASI_Rn02_00197990 predicted 2528
11 SASI_Rn01_00056785 predicted 581
12 SASI_Rn01_00056786 predicted 4988
13 SASI_Rn01_00056789 predicted 3222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009780 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317008 predicted 1522
2 SASI_Mm01_00038205 predicted 4289
3 SASI_Mm02_00317009 predicted 1522
4 SASI_Mm01_00038206 predicted 2972
5 SASI_Mm01_00038202 predicted 1232
6 SASI_Mm01_00038203 predicted 1122
7 SASI_Mm01_00038204 predicted 2604
8 SASI_Mm01_00038207 predicted 1801
9 SASI_Mm01_00038208 predicted 4241
10 SASI_Mm01_00038209 predicted 4904
11 SASI_Mm01_00038210 predicted 1554
12 SASI_Mm01_00038211 predicted 468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000592
C4B MISSION shRNA Bacterial Glycerol Stock
complement component 4B (Chido blood group)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000592.3-4272s1c1
Sequence:CCGGCGAGTACACGATGGAAGCAAACTCGAGTTTGCTTCCATCGTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000592.3-2996s1c1
Sequence:CCGGCCTCAGATCCATTGGACACTTCTCGAGAAGTGTCCAATGGATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000592.3-2613s1c1
Sequence:CCGGCCTCTATAACTACCTGGATAACTCGAGTTATCCAGGTAGTTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000592.3-2025s1c1
Sequence:CCGGCCAGTGGACCTTATCCAGAAACTCGAGTTTCTGGATAAGGTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000592.3-762s1c1
Sequence:CCGGCCTTCCCAACTTTGAGGTGAACTCGAGTTCACCTCAAAGTTGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000592
C4B MISSION shRNA shRNA Plasmid DNA
complement component 4B (Chido blood group)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000592.3-4272s1c1
Sequence:CCGGCGAGTACACGATGGAAGCAAACTCGAGTTTGCTTCCATCGTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000592.3-2996s1c1
Sequence:CCGGCCTCAGATCCATTGGACACTTCTCGAGAAGTGTCCAATGGATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000592.3-2613s1c1
Sequence:CCGGCCTCTATAACTACCTGGATAACTCGAGTTATCCAGGTAGTTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000592.3-2025s1c1
Sequence:CCGGCCAGTGGACCTTATCCAGAAACTCGAGTTTCTGGATAAGGTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000592.3-762s1c1
Sequence:CCGGCCTTCCCAACTTTGAGGTGAACTCGAGTTCACCTCAAAGTTGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000592
C4B MISSION shRNA Lentiviral Transduction Particles
complement component 4B (Chido blood group)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000592.3-4272s1c1
Sequence:CCGGCGAGTACACGATGGAAGCAAACTCGAGTTTGCTTCCATCGTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000592.3-2996s1c1
Sequence:CCGGCCTCAGATCCATTGGACACTTCTCGAGAAGTGTCCAATGGATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000592.3-2613s1c1
Sequence:CCGGCCTCTATAACTACCTGGATAACTCGAGTTATCCAGGTAGTTATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000592.3-2025s1c1
Sequence:CCGGCCAGTGGACCTTATCCAGAAACTCGAGTTTCTGGATAAGGTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000592.3-762s1c1
Sequence:CCGGCCTTCCCAACTTTGAGGTGAACTCGAGTTCACCTCAAAGTTGGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009780
C4B MISSION shRNA Bacterial Glycerol Stock
complement component 4B (Chido blood group)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009780.1-2821s1c1
Sequence:CCGGGCTGTGTCTAAGATTCTCCAACTCGAGTTGGAGAATCTTAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009780.1-1668s1c1
Sequence:CCGGCTCGTTCTACTTTGTGGCTTACTCGAGTAAGCCACAAAGTAGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009780.1-2584s1c1
Sequence:CCGGCGCTTTGAGCAGTTTGAATTACTCGAGTAATTCAAACTGCTCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009780.1-1243s1c1
Sequence:CCGGGCCTCCAACGTTCCTGTTAAACTCGAGTTTAACAGGAACGTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009780.1-4279s1c1
Sequence:CCGGGATGCCAATGAAGACTACGAACTCGAGTTCGTAGTCTTCATTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009780
C4B MISSION shRNA shRNA Plasmid DNA
complement component 4B (Chido blood group)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009780.1-2821s1c1
Sequence:CCGGGCTGTGTCTAAGATTCTCCAACTCGAGTTGGAGAATCTTAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009780.1-1668s1c1
Sequence:CCGGCTCGTTCTACTTTGTGGCTTACTCGAGTAAGCCACAAAGTAGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009780.1-2584s1c1
Sequence:CCGGCGCTTTGAGCAGTTTGAATTACTCGAGTAATTCAAACTGCTCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009780.1-1243s1c1
Sequence:CCGGGCCTCCAACGTTCCTGTTAAACTCGAGTTTAACAGGAACGTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009780.1-4279s1c1
Sequence:CCGGGATGCCAATGAAGACTACGAACTCGAGTTCGTAGTCTTCATTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009780
C4B MISSION shRNA Lentiviral Transduction Particles
complement component 4B (Chido blood group)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009780.1-2821s1c1
Sequence:CCGGGCTGTGTCTAAGATTCTCCAACTCGAGTTGGAGAATCTTAGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009780.1-1668s1c1
Sequence:CCGGCTCGTTCTACTTTGTGGCTTACTCGAGTAAGCCACAAAGTAGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009780.1-2584s1c1
Sequence:CCGGCGCTTTGAGCAGTTTGAATTACTCGAGTAATTCAAACTGCTCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009780.1-1243s1c1
Sequence:CCGGGCCTCCAACGTTCCTGTTAAACTCGAGTTTAACAGGAACGTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009780.1-4279s1c1
Sequence:CCGGGATGCCAATGAAGACTACGAACTCGAGTTCGTAGTCTTCATTGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002029
C4B MISSION shRNA Bacterial Glycerol Stock
complement component 4B (Chido blood group)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002029.1-4272s1c1
Sequence:CCGGCGAGTACACGATGGAAGCAAACTCGAGTTTGCTTCCATCGTGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002029.1-906s1c1
Sequence:CCGGGCTCCTAGATGAGGATGGTAACTCGAGTTACCATCCTCATCTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002029.1-5004s1c1
Sequence:CCGGGCACTTCACCAAGGATGTCAACTCGAGTTGACATCCTTGGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002029.1-222s1c1
Sequence:CCGGCCTGAGAAACCCATCTCGTAACTCGAGTTACGAGATGGGTTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002029.1-2996s1c2
Sequence:CCGGCCTCAGATCCATTGGACACTTCTCGAGAAGTGTCCAATGGATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002029
C4B MISSION shRNA shRNA Plasmid DNA
complement component 4B (Chido blood group)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002029.1-4272s1c1
Sequence:CCGGCGAGTACACGATGGAAGCAAACTCGAGTTTGCTTCCATCGTGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002029.1-906s1c1
Sequence:CCGGGCTCCTAGATGAGGATGGTAACTCGAGTTACCATCCTCATCTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002029.1-5004s1c1
Sequence:CCGGGCACTTCACCAAGGATGTCAACTCGAGTTGACATCCTTGGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002029.1-222s1c1
Sequence:CCGGCCTGAGAAACCCATCTCGTAACTCGAGTTACGAGATGGGTTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002029.1-2996s1c2
Sequence:CCGGCCTCAGATCCATTGGACACTTCTCGAGAAGTGTCCAATGGATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002029
C4B MISSION shRNA Lentiviral Transduction Particles
complement component 4B (Chido blood group)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002029.1-4272s1c1
Sequence:CCGGCGAGTACACGATGGAAGCAAACTCGAGTTTGCTTCCATCGTGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002029.1-906s1c1
Sequence:CCGGGCTCCTAGATGAGGATGGTAACTCGAGTTACCATCCTCATCTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002029.1-5004s1c1
Sequence:CCGGGCACTTCACCAAGGATGTCAACTCGAGTTGACATCCTTGGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188100    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002029.1-222s1c1
Sequence:CCGGCCTGAGAAACCCATCTCGTAACTCGAGTTACGAGATGGGTTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001002029.1-2996s1c2
Sequence:CCGGCCTCAGATCCATTGGACACTTCTCGAGAAGTGTCCAATGGATCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks