EMAIL THIS PAGE TO A FRIEND

C4BPA

complement component 4 binding protein, alpha

40 Gene Product Result for
Synonyms: C4BP PRP
UniProtKB ID: P04003
Gene ID:
Human(722) Summary: This gene encodes a member of a superfamily of proteins composed predominantly of tandemly arrayed short consensus repeats of approximately 60 amino acids. Along with a single, unique beta-chain, seven identical alpha-chains encoded by this gene assemble into the predominant isoform of C4b-binding protein, a multimeric protein that controls activation of the complement cascade through the classical pathway. The genes encoding both alpha and beta chains are located adjacent to each other on human chromosome 1 in the regulator of complement activation gene cluster. Two pseudogenes of this gene are also found in the cluster. [provided by RefSeq, Jul 2008]
Rat(24235) complement component 4 binding protein, alpha
naked mole-rat(101721321) complement component 4 binding protein, alpha
domestic guinea pig(100379238) complement component 4 binding protein, alpha
chicken(395384) complement component 4 binding protein, alpha
Horse(100056222) complement component 4 binding protein, alpha
domestic cat(101094897) complement component 4 binding protein, alpha
dog(100687316) complement component 4 binding protein, alpha
cow(281651) complement component 4 binding protein, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0475 AQUA Peptide LSLEIEQLELQ[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000715 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144071 MISSION® esiRNA esiRNA human C4BPA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000715 Rosetta Predictions human pricing
NM_012516 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177569 predicted 551
2 SASI_Hs01_00177570 predicted 1554
3 SASI_Hs01_00177571 predicted 276
4 SASI_Hs01_00177572 predicted 1545
5 SASI_Hs01_00177573 predicted 692
6 SASI_Hs01_00177574 predicted 1585
7 SASI_Hs02_00303126 predicted 1036
8 SASI_Hs01_00177575 predicted 1190
9 SASI_Hs01_00177578 predicted 1123
10 SASI_Hs02_00303127 predicted 1384
11 SASI_Hs01_00177576 predicted 1496
12 SASI_Hs01_00177577 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012516 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101915 predicted 609
2 SASI_Rn01_00101917 predicted 2036
3 SASI_Rn01_00101918 predicted 1376
4 SASI_Rn01_00101919 predicted 1933
5 SASI_Rn02_00259578 predicted 874
6 SASI_Rn02_00259579 predicted 1225
7 SASI_Rn01_00101921 predicted 1244
8 SASI_Rn01_00101922 predicted 1739
9 SASI_Rn02_00259580 predicted 1634
10 SASI_Rn01_00101924 predicted 839
11 SASI_Rn01_00101916 predicted 1033
12 SASI_Rn01_00101920 predicted 1052
13 SASI_Rn01_00101923 predicted 1949
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000715
C4BPA MISSION shRNA Bacterial Glycerol Stock
complement component 4 binding protein, alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000715.3-1953s21c1
Sequence:CCGGAGCGCAAGACAATCCACTTTGCTCGAGCAAAGTGGATTGTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000715.3-948s21c1
Sequence:CCGGGGATTTGGACCCATCTATAATCTCGAGATTATAGATGGGTCCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000715.3-537s21c1
Sequence:CCGGCACCCAGGAGAGTTACGTAATCTCGAGATTACGTAACTCTCCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-979s1c2
Sequence:CCGGCTATTGTGTTTAAGTGCCAAACTCGAGTTTGGCACTTAAACACAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-478s1c1
Sequence:CCGGCCTGTAATTCTGATGGCGAATCTCGAGATTCGCCATCAGAATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-1551s1c1
Sequence:CCGGGAATGTGATAAAGGCTACATTCTCGAGAATGTAGCCTTTATCACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-1923s1c1
Sequence:CCGGGAAATTGAACAACTGGAACTACTCGAGTAGTTCCAGTTGTTCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-979s1c1
Sequence:CCGGCTATTGTGTTTAAGTGCCAAACTCGAGTTTGGCACTTAAACACAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-457s1c1
Sequence:CCGGCCCATTCAACTCAGACGCTTACTCGAGTAAGCGTCTGAGTTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000715
C4BPA MISSION shRNA shRNA Plasmid DNA
complement component 4 binding protein, alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000715.3-1953s21c1
Sequence:CCGGAGCGCAAGACAATCCACTTTGCTCGAGCAAAGTGGATTGTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000715.3-948s21c1
Sequence:CCGGGGATTTGGACCCATCTATAATCTCGAGATTATAGATGGGTCCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000715.3-537s21c1
Sequence:CCGGCACCCAGGAGAGTTACGTAATCTCGAGATTACGTAACTCTCCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-979s1c2
Sequence:CCGGCTATTGTGTTTAAGTGCCAAACTCGAGTTTGGCACTTAAACACAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-478s1c1
Sequence:CCGGCCTGTAATTCTGATGGCGAATCTCGAGATTCGCCATCAGAATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-1551s1c1
Sequence:CCGGGAATGTGATAAAGGCTACATTCTCGAGAATGTAGCCTTTATCACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-1923s1c1
Sequence:CCGGGAAATTGAACAACTGGAACTACTCGAGTAGTTCCAGTTGTTCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-979s1c1
Sequence:CCGGCTATTGTGTTTAAGTGCCAAACTCGAGTTTGGCACTTAAACACAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-457s1c1
Sequence:CCGGCCCATTCAACTCAGACGCTTACTCGAGTAAGCGTCTGAGTTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000715
C4BPA MISSION shRNA Lentiviral Transduction Particles
complement component 4 binding protein, alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000715.3-1953s21c1
Sequence:CCGGAGCGCAAGACAATCCACTTTGCTCGAGCAAAGTGGATTGTCTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000715.3-948s21c1
Sequence:CCGGGGATTTGGACCCATCTATAATCTCGAGATTATAGATGGGTCCAAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000715.3-537s21c1
Sequence:CCGGCACCCAGGAGAGTTACGTAATCTCGAGATTACGTAACTCTCCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-979s1c2
Sequence:CCGGCTATTGTGTTTAAGTGCCAAACTCGAGTTTGGCACTTAAACACAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-478s1c1
Sequence:CCGGCCTGTAATTCTGATGGCGAATCTCGAGATTCGCCATCAGAATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-1551s1c1
Sequence:CCGGGAATGTGATAAAGGCTACATTCTCGAGAATGTAGCCTTTATCACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-1923s1c1
Sequence:CCGGGAAATTGAACAACTGGAACTACTCGAGTAGTTCCAGTTGTTCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-979s1c1
Sequence:CCGGCTATTGTGTTTAAGTGCCAAACTCGAGTTTGGCACTTAAACACAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000715.2-457s1c1
Sequence:CCGGCCCATTCAACTCAGACGCTTACTCGAGTAAGCGTCTGAGTTGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks