EMAIL THIS PAGE TO A FRIEND

C4BPB

complement component 4 binding protein, beta

89 Gene Product Result for
Synonyms: C4BP
UniProtKB ID: P20851, A5JYP8, D3DT81, Q5VVR0, Q9BS25
Gene ID:
Human(725) Summary: This gene encodes a member of a superfamily of proteins composed predominantly of tandemly arrayed short consensus repeats of approximately 60 amino acids. A single, unique beta-chain encoded by this gene assembles with seven identical alpha-chains into the predominant isoform of C4b-binding protein, a multimeric protein that controls activation of the complement cascade through the classical pathway. C4b-binding protein has a regulatory role in the coagulation system also, mediated through the beta-chain binding of protein S, a vitamin K-dependent protein that serves as a cofactor of activated protein C. The genes encoding both alpha and beta chains are located adjacent to each other on human chromosome 1 in the regulator of complement activation gene cluster. Alternative splicing gives rise to multiple transcript variants. [provided by RefSeq, Jul 2008]
Rat(24236) complement component 4 binding protein, beta
cow(281652) complement component 4 binding protein, beta
domestic cat(101095148) complement component 4 binding protein, beta
dog(609285) complement component 4 binding protein, beta
domestic guinea pig(100713956) complement component 4 binding protein, beta
naked mole-rat(101720955) complement component 4 binding protein, beta
sheep(101114204) complement component 4 binding protein, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000716 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052671 MISSION® esiRNA esiRNA human C4BPB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000716 Rosetta Predictions human pricing
NM_001017364 Rosetta Predictions human pricing
NM_001017365 Rosetta Predictions human pricing
NM_001017366 Rosetta Predictions human pricing
NM_001017367 Rosetta Predictions human pricing
NM_016995 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144508 predicted 716
2 SASI_Hs02_00303128 predicted 766
3 SASI_Hs01_00144510 predicted 750
4 SASI_Hs01_00144511 predicted 714
5 SASI_Hs01_00144512 predicted 713
6 SASI_Hs01_00144513 predicted 576
7 SASI_Hs01_00144514 predicted 637
8 SASI_Hs01_00144515 predicted 873
9 SASI_Hs01_00144516 predicted 759
10 SASI_Hs02_00303129 predicted 576
11 SASI_Hs01_00144509 predicted 852
12 SASI_Hs01_00144517 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061591 predicted 711
2 SASI_Hs02_00306699 predicted 760
3 SASI_Hs01_00061593 predicted 748
4 SASI_Hs01_00061594 predicted 717
5 SASI_Hs01_00061595 predicted 716
6 SASI_Hs01_00061596 predicted 566
7 SASI_Hs01_00061597 predicted 631
8 SASI_Hs01_00061598 predicted 872
9 SASI_Hs01_00061599 predicted 757
10 SASI_Hs02_00306700 predicted 572
11 SASI_Hs01_00061592 predicted 851
12 SASI_Hs01_00061600 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226809 predicted 551
2 SASI_Hs02_00306701 predicted 604
3 SASI_Hs01_00226811 predicted 589
4 SASI_Hs01_00226812 predicted 557
5 SASI_Hs01_00226813 predicted 556
6 SASI_Hs01_00226814 predicted 408
7 SASI_Hs01_00226815 predicted 475
8 SASI_Hs01_00226816 predicted 712
9 SASI_Hs01_00226817 predicted 588
10 SASI_Hs02_00306702 predicted 410
11 SASI_Hs01_00226810 predicted 691
12 SASI_Hs01_00226818 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137311 predicted 546
2 SASI_Hs02_00306703 predicted 599
3 SASI_Hs01_00137313 predicted 586
4 SASI_Hs01_00137314 predicted 552
5 SASI_Hs01_00137315 predicted 545
6 SASI_Hs01_00137316 predicted 410
7 SASI_Hs01_00137317 predicted 472
8 SASI_Hs01_00137318 predicted 709
9 SASI_Hs01_00137319 predicted 594
10 SASI_Hs02_00306704 predicted 406
11 SASI_Hs01_00137312 predicted 688
12 SASI_Hs01_00137320 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190317 predicted 552
2 SASI_Hs02_00306705 predicted 601
3 SASI_Hs01_00190319 predicted 584
4 SASI_Hs01_00190320 predicted 554
5 SASI_Hs01_00190321 predicted 551
6 SASI_Hs01_00190322 predicted 406
7 SASI_Hs01_00190323 predicted 471
8 SASI_Hs01_00190324 predicted 718
9 SASI_Hs01_00190325 predicted 588
10 SASI_Hs02_00306706 predicted 409
11 SASI_Hs01_00190318 predicted 688
12 SASI_Hs01_00190326 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261135 predicted 740
2 SASI_Rn01_00072184 predicted 702
3 SASI_Rn01_00072185 predicted 623
4 SASI_Rn01_00072187 predicted 696
5 SASI_Rn02_00261136 predicted 665
6 SASI_Rn01_00072189 predicted 579
7 SASI_Rn01_00072190 predicted 326
8 SASI_Rn01_00072191 predicted 736
9 SASI_Rn02_00261137 predicted 866
10 SASI_Rn02_00261138 predicted 560
11 SASI_Rn01_00072183 predicted 406
12 SASI_Rn01_00072186 predicted 448
13 SASI_Rn01_00072188 predicted 359
14 SASI_Rn01_00072192 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000716
C4BPB MISSION shRNA Bacterial Glycerol Stock
complement component 4 binding protein, beta
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000716.2-564s1c1
Sequence:CCGGCCTGTGAATGTAAGTGACAAACTCGAGTTTGTCACTTACATTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000716.2-360s1c1
Sequence:CCGGCCAGTGGACAATAGCATATTTCTCGAGAAATATGCTATTGTCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000716.2-846s1c1
Sequence:CCGGGTCTGCAAGTTGATCCAGGAACTCGAGTTCCTGGATCAACTTGCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000716.2-909s1c1
Sequence:CCGGGAGAGTAAGAACCTCTGCGAACTCGAGTTCGCAGAGGTTCTTACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000716.2-729s1c1
Sequence:CCGGGAAGGAAATAACTTCACCTTACTCGAGTAAGGTGAAGTTATTTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000716.3-787s21c1
Sequence:CCGGGTGAAGACAGGTACTACTTAGCTCGAGCTAAGTAGTACCTGTCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000716.3-950s21c1
Sequence:CCGGGGAGAACTTTATGCAACAATTCTCGAGAATTGTTGCATAAAGTTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000716
C4BPB MISSION shRNA shRNA Plasmid DNA
complement component 4 binding protein, beta
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000716.2-564s1c1
Sequence:CCGGCCTGTGAATGTAAGTGACAAACTCGAGTTTGTCACTTACATTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000716.2-360s1c1
Sequence:CCGGCCAGTGGACAATAGCATATTTCTCGAGAAATATGCTATTGTCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000716.2-846s1c1
Sequence:CCGGGTCTGCAAGTTGATCCAGGAACTCGAGTTCCTGGATCAACTTGCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000716.2-909s1c1
Sequence:CCGGGAGAGTAAGAACCTCTGCGAACTCGAGTTCGCAGAGGTTCTTACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000716.2-729s1c1
Sequence:CCGGGAAGGAAATAACTTCACCTTACTCGAGTAAGGTGAAGTTATTTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000716.3-787s21c1
Sequence:CCGGGTGAAGACAGGTACTACTTAGCTCGAGCTAAGTAGTACCTGTCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000716.3-950s21c1
Sequence:CCGGGGAGAACTTTATGCAACAATTCTCGAGAATTGTTGCATAAAGTTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000716
C4BPB MISSION shRNA Lentiviral Transduction Particles
complement component 4 binding protein, beta
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000716.2-564s1c1
Sequence:CCGGCCTGTGAATGTAAGTGACAAACTCGAGTTTGTCACTTACATTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000716.2-360s1c1
Sequence:CCGGCCAGTGGACAATAGCATATTTCTCGAGAAATATGCTATTGTCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000716.2-846s1c1
Sequence:CCGGGTCTGCAAGTTGATCCAGGAACTCGAGTTCCTGGATCAACTTGCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000716.2-909s1c1
Sequence:CCGGGAGAGTAAGAACCTCTGCGAACTCGAGTTCGCAGAGGTTCTTACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000716.2-729s1c1
Sequence:CCGGGAAGGAAATAACTTCACCTTACTCGAGTAAGGTGAAGTTATTTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000716.3-787s21c1
Sequence:CCGGGTGAAGACAGGTACTACTTAGCTCGAGCTAAGTAGTACCTGTCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000716.3-950s21c1
Sequence:CCGGGGAGAACTTTATGCAACAATTCTCGAGAATTGTTGCATAAAGTTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)