EMAIL THIS PAGE TO A FRIEND

C4orf17

chromosome 4 open reading frame 17

32 Gene Product Result for
UniProtKB ID: Q53FE4, Q6FI84, Q6IS77, Q9H0D9
Gene ID:
chicken(772145) chromosome 4 open reading frame, human C4orf17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032149 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032149 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032149 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048591 MISSION® esiRNA esiRNA human C4orf17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032149 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168112 predicted 822
2 SASI_Hs01_00168113 predicted 647
3 SASI_Hs01_00168114 predicted 341
4 SASI_Hs01_00168115 predicted 472
5 SASI_Hs01_00168116 predicted 630
6 SASI_Hs01_00168117 predicted 1159
7 SASI_Hs01_00168118 predicted 488
8 SASI_Hs01_00168119 predicted 823
9 SASI_Hs01_00168120 predicted 473
10 SASI_Hs01_00168121 predicted 381
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032149
C4orf17 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 17
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032149.1-362s21c1
Sequence:CCGGGGGCAAAGGCAGCCATATTATCTCGAGATAATATGGCTGCCTTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032149.1-988s21c1
Sequence:CCGGTTGCCGAGATAAACCTGTTAACTCGAGTTAACAGGTTTATCTCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032149.1-698s21c1
Sequence:CCGGCAGTGAGAATCCCTTAGTAATCTCGAGATTACTAAGGGATTCTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032149.1-1213s21c1
Sequence:CCGGACAAGCCTCCACTACTTATAACTCGAGTTATAAGTAGTGGAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032149.1-1431s21c1
Sequence:CCGGTGAATATGAGCTTCACATTTACTCGAGTAAATGTGAAGCTCATATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032149.1-1440s1c1
Sequence:CCGGGCTTCACATTTACATCATCAACTCGAGTTGATGATGTAAATGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032149.1-1165s1c1
Sequence:CCGGCAAGTCAAGGATCTGAAGAAACTCGAGTTTCTTCAGATCCTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032149
C4orf17 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 17
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032149.1-362s21c1
Sequence:CCGGGGGCAAAGGCAGCCATATTATCTCGAGATAATATGGCTGCCTTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032149.1-988s21c1
Sequence:CCGGTTGCCGAGATAAACCTGTTAACTCGAGTTAACAGGTTTATCTCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032149.1-698s21c1
Sequence:CCGGCAGTGAGAATCCCTTAGTAATCTCGAGATTACTAAGGGATTCTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032149.1-1213s21c1
Sequence:CCGGACAAGCCTCCACTACTTATAACTCGAGTTATAAGTAGTGGAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032149.1-1431s21c1
Sequence:CCGGTGAATATGAGCTTCACATTTACTCGAGTAAATGTGAAGCTCATATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032149.1-1440s1c1
Sequence:CCGGGCTTCACATTTACATCATCAACTCGAGTTGATGATGTAAATGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032149.1-1165s1c1
Sequence:CCGGCAAGTCAAGGATCTGAAGAAACTCGAGTTTCTTCAGATCCTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032149
C4orf17 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 17
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032149.1-362s21c1
Sequence:CCGGGGGCAAAGGCAGCCATATTATCTCGAGATAATATGGCTGCCTTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032149.1-988s21c1
Sequence:CCGGTTGCCGAGATAAACCTGTTAACTCGAGTTAACAGGTTTATCTCGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032149.1-698s21c1
Sequence:CCGGCAGTGAGAATCCCTTAGTAATCTCGAGATTACTAAGGGATTCTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032149.1-1213s21c1
Sequence:CCGGACAAGCCTCCACTACTTATAACTCGAGTTATAAGTAGTGGAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032149.1-1431s21c1
Sequence:CCGGTGAATATGAGCTTCACATTTACTCGAGTAAATGTGAAGCTCATATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167682    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032149.1-1440s1c1
Sequence:CCGGGCTTCACATTTACATCATCAACTCGAGTTGATGATGTAAATGTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032149.1-1165s1c1
Sequence:CCGGCAAGTCAAGGATCTGAAGAAACTCGAGTTTCTTCAGATCCTTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks