EMAIL THIS PAGE TO A FRIEND

C4orf19

chromosome 4 open reading frame 19

105 Gene Product Result for
UniProtKB ID: Q8IY42, Q9NV03
Gene ID:
chicken(768841) chromosome 4 open reading frame, human C4orf19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018302 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018302 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018302 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148841 MISSION® esiRNA esiRNA human C4orf19 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001104629 Rosetta Predictions human pricing
NM_018302 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323814 predicted 899
2 SASI_Hs02_00323815 predicted 1359
3 SASI_Hs02_00323816 predicted 769
4 SASI_Hs02_00323817 predicted 1203
5 SASI_Hs02_00323818 predicted 821
6 SASI_Hs02_00323819 predicted 800
7 SASI_Hs02_00323820 predicted 817
8 SASI_Hs02_00323821 predicted 769
9 SASI_Hs02_00323822 predicted 1421
10 SASI_Hs02_00323823 predicted 1156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018302 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060869 predicted 886
2 SASI_Hs01_00060870 predicted 1360
3 SASI_Hs01_00060871 predicted 757
4 SASI_Hs01_00060872 predicted 1197
5 SASI_Hs01_00060874 predicted 811
6 SASI_Hs01_00060875 predicted 801
7 SASI_Hs02_00351711 predicted 817
8 SASI_Hs01_00060877 predicted 759
9 SASI_Hs01_00060878 predicted 1413
10 SASI_Hs02_00351712 predicted 1148
11 SASI_Hs01_00060873 predicted 1308
12 SASI_Hs01_00060876 predicted 213
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018302
C4orf19 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 19
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018302.1-926s1c1
Sequence:CCGGGTTCTAAGCATCTGCTTTAATCTCGAGATTAAAGCAGATGCTTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018302.1-270s1c1
Sequence:CCGGGCAAGCTAGATGAAGACGACACTCGAGTGTCGTCTTCATCTAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018302.2-638s21c1
Sequence:CCGGGGGACCCAAGTCATGAGAAATCTCGAGATTTCTCATGACTTGGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018302.2-279s21c1
Sequence:CCGGATGAAGACGACACTGATAAATCTCGAGATTTATCAGTGTCGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018302.2-763s21c1
Sequence:CCGGTGGAGACAACGTTGATCATAACTCGAGTTATGATCAACGTTGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018302.2-3169s21c1
Sequence:CCGGATCGCAAGTGACCTCTATATACTCGAGTATATAGAGGTCACTTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018302.2-884s21c1
Sequence:CCGGAGGAGAAGCTGGGATTCATTGCTCGAGCAATGAATCCCAGCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018302
C4orf19 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 19
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018302.1-926s1c1
Sequence:CCGGGTTCTAAGCATCTGCTTTAATCTCGAGATTAAAGCAGATGCTTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018302.1-270s1c1
Sequence:CCGGGCAAGCTAGATGAAGACGACACTCGAGTGTCGTCTTCATCTAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018302.2-638s21c1
Sequence:CCGGGGGACCCAAGTCATGAGAAATCTCGAGATTTCTCATGACTTGGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018302.2-279s21c1
Sequence:CCGGATGAAGACGACACTGATAAATCTCGAGATTTATCAGTGTCGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018302.2-763s21c1
Sequence:CCGGTGGAGACAACGTTGATCATAACTCGAGTTATGATCAACGTTGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018302.2-3169s21c1
Sequence:CCGGATCGCAAGTGACCTCTATATACTCGAGTATATAGAGGTCACTTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018302.2-884s21c1
Sequence:CCGGAGGAGAAGCTGGGATTCATTGCTCGAGCAATGAATCCCAGCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018302
C4orf19 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 19
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018302.1-926s1c1
Sequence:CCGGGTTCTAAGCATCTGCTTTAATCTCGAGATTAAAGCAGATGCTTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018302.1-270s1c1
Sequence:CCGGGCAAGCTAGATGAAGACGACACTCGAGTGTCGTCTTCATCTAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018302.2-638s21c1
Sequence:CCGGGGGACCCAAGTCATGAGAAATCTCGAGATTTCTCATGACTTGGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018302.2-279s21c1
Sequence:CCGGATGAAGACGACACTGATAAATCTCGAGATTTATCAGTGTCGTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018302.2-763s21c1
Sequence:CCGGTGGAGACAACGTTGATCATAACTCGAGTTATGATCAACGTTGTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018302.2-3169s21c1
Sequence:CCGGATCGCAAGTGACCTCTATATACTCGAGTATATAGAGGTCACTTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018302.2-884s21c1
Sequence:CCGGAGGAGAAGCTGGGATTCATTGCTCGAGCAATGAATCCCAGCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks