EMAIL THIS PAGE TO A FRIEND

C4orf21

chromosome 4 open reading frame 21

24 Gene Product Result for
Species: Human C4orf21(55345)
UniProtKB ID: Q86YA3, Q9NUJ4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018392 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018392 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018392 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070801 MISSION® esiRNA esiRNA human C4orf21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018392 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145933 predicted 2616
2 SASI_Hs01_00145934 predicted 916
3 SASI_Hs01_00145935 predicted 837
4 SASI_Hs01_00145936 predicted 2056
5 SASI_Hs01_00145939 predicted 1338
6 SASI_Hs01_00145940 predicted 238
7 SASI_Hs02_00351883 predicted 2762
8 SASI_Hs02_00351884 predicted 2807
9 SASI_Hs01_00145941 predicted 300
10 SASI_Hs02_00351885 predicted 1871
11 SASI_Hs01_00145937 predicted 2712
12 SASI_Hs01_00145938 predicted 1570
13 SASI_Hs01_00145942 predicted 318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018392
VALIDATED
C4orf21 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 21
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018392.3-2675s1c1
Sequence:CCGGGCAAGGAACTCAACAGACGTACTCGAGTACGTCTGTTGAGTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018392.3-1351s1c1
Sequence:CCGGGCAGTAGCTTACAGGTTACTTCTCGAGAAGTAACCTGTAAGCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018392.3-2802s1c1
Sequence:CCGGGTTGAACTAAGTGAACCACTTCTCGAGAAGTGGTTCACTTAGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018392.3-480s1c1
Sequence:CCGGCCACGTCAGGTTCCAAAGAAACTCGAGTTTCTTTGGAACCTGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018392.3-3201s1c1
Sequence:CCGGGCAAGAACTTTACCTGATGATCTCGAGATCATCAGGTAAAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018392.3-2950s1c1
Sequence:CCGGGATCAGCTACTAGTGGTGTAACTCGAGTTACACCACTAGTAGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018392
VALIDATED
C4orf21 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 21
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018392.3-2675s1c1
Sequence:CCGGGCAAGGAACTCAACAGACGTACTCGAGTACGTCTGTTGAGTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018392.3-1351s1c1
Sequence:CCGGGCAGTAGCTTACAGGTTACTTCTCGAGAAGTAACCTGTAAGCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018392.3-2802s1c1
Sequence:CCGGGTTGAACTAAGTGAACCACTTCTCGAGAAGTGGTTCACTTAGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018392.3-480s1c1
Sequence:CCGGCCACGTCAGGTTCCAAAGAAACTCGAGTTTCTTTGGAACCTGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018392.3-3201s1c1
Sequence:CCGGGCAAGAACTTTACCTGATGATCTCGAGATCATCAGGTAAAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018392.3-2950s1c1
Sequence:CCGGGATCAGCTACTAGTGGTGTAACTCGAGTTACACCACTAGTAGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018392
VALIDATED
C4orf21 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 21
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018392.3-2675s1c1
Sequence:CCGGGCAAGGAACTCAACAGACGTACTCGAGTACGTCTGTTGAGTTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018392.3-1351s1c1
Sequence:CCGGGCAGTAGCTTACAGGTTACTTCTCGAGAAGTAACCTGTAAGCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018392.3-2802s1c1
Sequence:CCGGGTTGAACTAAGTGAACCACTTCTCGAGAAGTGGTTCACTTAGTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018392.3-480s1c1
Sequence:CCGGCCACGTCAGGTTCCAAAGAAACTCGAGTTTCTTTGGAACCTGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018392.3-3201s1c1
Sequence:CCGGGCAAGAACTTTACCTGATGATCTCGAGATCATCAGGTAAAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018392.3-2950s1c1
Sequence:CCGGGATCAGCTACTAGTGGTGTAACTCGAGTTACACCACTAGTAGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks