EMAIL THIS PAGE TO A FRIEND

C4orf26

chromosome 4 open reading frame 26

Species: Human C4orf26(152816)
UniProtKB ID: Q17RF5, B4DTI3, E7ETQ0, Q8TEC3
Gene ID:
Human(152816) Summary: Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene is thought to encode an extracellular matrix acidic phosphoprotein that has a function in enamel mineralization during amelogenesis. Mutations in this gene are associated with recessive hypomineralized amelogenesis imperfecta. [provided by RefSeq, Oct 2012]
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302145 ANTI-C4ORF26 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178497 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008411 MISSION® esiRNA esiRNA targeting human C4orf26 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178497 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192334 predicted 204
2 SASI_Hs01_00192335 predicted 231
3 SASI_Hs01_00192337 predicted 207
4 SASI_Hs01_00192338 predicted 225
5 SASI_Hs01_00192336 predicted 206
6 SASI_Hs02_00369735 predicted 146
7 SASI_Hs01_00192339 predicted 351
8 SASI_Hs02_00369736 predicted 665
9 SASI_Hs01_00192340 predicted 538
10 SASI_Hs01_00192341 predicted 357
11 SASI_Hs01_00192342 predicted 535
12 SASI_Hs01_00192343 predicted 295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178497
C4orf26 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 26
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178497.2-154s21c1
Sequence:CCGGCTACCGACTGCCAGATCTTTACTCGAGTAAAGATCTGGCAGTCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178497.2-303s21c1
Sequence:CCGGTTCGTCCCTTCAAGGTGTAACCTCGAGGTTACACCTTGAAGGGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178497.2-263s21c1
Sequence:CCGGACGAAGGCCCAGAATCCATTTCTCGAGAAATGGATTCTGGGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178497.2-403s1c1
Sequence:CCGGGAGGAAGCTCATCTGAGGAAACTCGAGTTTCCTCAGATGAGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178497.2-96s1c1
Sequence:CCGGGCAGAAGGACAAGAAGAGGTACTCGAGTACCTCTTCTTGTCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178497.2-97s1c1
Sequence:CCGGCAGAAGGACAAGAAGAGGTATCTCGAGATACCTCTTCTTGTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178497.2-573s1c1
Sequence:CCGGGTTCTCTTTGTCAGCAGTGAACTCGAGTTCACTGCTGACAAAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178497.2-578s1c1
Sequence:CCGGCTTTGTCAGCAGTGAAGATATCTCGAGATATCTTCACTGCTGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178497.2-359s1c1
Sequence:CCGGCCGTTACCTTACTTATAGGTACTCGAGTACCTATAAGTAAGGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178497.2-555s1c1
Sequence:CCGGCATCACTGACTAGAAACTGTTCTCGAGAACAGTTTCTAGTCAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178497.2-62s1c1
Sequence:CCGGCTGGTTACTGGTATGCTGGTTCTCGAGAACCAGCATACCAGTAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178497
C4orf26 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 26
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178497.2-154s21c1
Sequence:CCGGCTACCGACTGCCAGATCTTTACTCGAGTAAAGATCTGGCAGTCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178497.2-303s21c1
Sequence:CCGGTTCGTCCCTTCAAGGTGTAACCTCGAGGTTACACCTTGAAGGGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178497.2-263s21c1
Sequence:CCGGACGAAGGCCCAGAATCCATTTCTCGAGAAATGGATTCTGGGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178497.2-403s1c1
Sequence:CCGGGAGGAAGCTCATCTGAGGAAACTCGAGTTTCCTCAGATGAGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178497.2-96s1c1
Sequence:CCGGGCAGAAGGACAAGAAGAGGTACTCGAGTACCTCTTCTTGTCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178497.2-97s1c1
Sequence:CCGGCAGAAGGACAAGAAGAGGTATCTCGAGATACCTCTTCTTGTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178497.2-573s1c1
Sequence:CCGGGTTCTCTTTGTCAGCAGTGAACTCGAGTTCACTGCTGACAAAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178497.2-578s1c1
Sequence:CCGGCTTTGTCAGCAGTGAAGATATCTCGAGATATCTTCACTGCTGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178497.2-359s1c1
Sequence:CCGGCCGTTACCTTACTTATAGGTACTCGAGTACCTATAAGTAAGGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178497.2-555s1c1
Sequence:CCGGCATCACTGACTAGAAACTGTTCTCGAGAACAGTTTCTAGTCAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178497.2-62s1c1
Sequence:CCGGCTGGTTACTGGTATGCTGGTTCTCGAGAACCAGCATACCAGTAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178497
C4orf26 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 26
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178497.2-154s21c1
Sequence:CCGGCTACCGACTGCCAGATCTTTACTCGAGTAAAGATCTGGCAGTCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178497.2-303s21c1
Sequence:CCGGTTCGTCCCTTCAAGGTGTAACCTCGAGGTTACACCTTGAAGGGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178497.2-263s21c1
Sequence:CCGGACGAAGGCCCAGAATCCATTTCTCGAGAAATGGATTCTGGGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178497.2-403s1c1
Sequence:CCGGGAGGAAGCTCATCTGAGGAAACTCGAGTTTCCTCAGATGAGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178497.2-96s1c1
Sequence:CCGGGCAGAAGGACAAGAAGAGGTACTCGAGTACCTCTTCTTGTCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178497.2-97s1c1
Sequence:CCGGCAGAAGGACAAGAAGAGGTATCTCGAGATACCTCTTCTTGTCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178497.2-573s1c1
Sequence:CCGGGTTCTCTTTGTCAGCAGTGAACTCGAGTTCACTGCTGACAAAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134792    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178497.2-578s1c1
Sequence:CCGGCTTTGTCAGCAGTGAAGATATCTCGAGATATCTTCACTGCTGACAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178497.2-359s1c1
Sequence:CCGGCCGTTACCTTACTTATAGGTACTCGAGTACCTATAAGTAAGGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178497.2-555s1c1
Sequence:CCGGCATCACTGACTAGAAACTGTTCTCGAGAACAGTTTCTAGTCAGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178497.2-62s1c1
Sequence:CCGGCTGGTTACTGGTATGCTGGTTCTCGAGAACCAGCATACCAGTAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks