EMAIL THIS PAGE TO A FRIEND

C4orf27

chromosome 4 open reading frame 27

28 Gene Product Result for
Species: Human C4orf27(54969)
UniProtKB ID: Q9NWY4
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017867 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017867 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017867 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109231 MISSION® esiRNA esiRNA human C4orf27 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017867 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350787 predicted 838
2 SASI_Hs02_00350788 predicted 839
3 SASI_Hs02_00350789 predicted 870
4 SASI_Hs02_00350790 predicted 277
5 SASI_Hs02_00350791 predicted 284
6 SASI_Hs02_00350792 predicted 212
7 SASI_Hs02_00350793 predicted 266
8 SASI_Hs02_00350794 predicted 871
9 SASI_Hs02_00350795 predicted 281
10 SASI_Hs02_00350796 predicted 930
11 SASI_Hs01_00141772 predicted 630
12 SASI_Hs01_00141773 predicted 539
13 SASI_Hs01_00141774 predicted 693
14 SASI_Hs01_00141775 predicted 690
15 SASI_Hs01_00141776 predicted 706
16 SASI_Hs01_00141777 predicted 617
17 SASI_Hs01_00141778 predicted 368
18 SASI_Hs01_00141779 predicted 599
19 SASI_Hs01_00141780 predicted 680
20 SASI_Hs01_00141781 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017867
VALIDATED
C4orf27 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 27
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_017867.1-626s1c1
Sequence:CCGGGCTTGAACAGAGAACCGTGAACTCGAGTTCACGGTTCTCTGTTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_017867.1-697s1c1
Sequence:CCGGGCTTGGTTGTTCCAGTAGATACTCGAGTATCTACTGGAACAACCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017867.1-365s1c1
Sequence:CCGGCCAGACCATTATTATCGGAGACTCGAGTCTCCGATAATAATGGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017867.1-1032s1c1
Sequence:CCGGCAAGAGAACATAGACCAACTTCTCGAGAAGTTGGTCTATGTTCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017867.1-829s1c1
Sequence:CCGGCCATTCAGGAAATGATGACTTCTCGAGAAGTCATCATTTCCTGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017867.1-223s1c1
Sequence:CCGGCATCTGATTCACTTTCTGCAACTCGAGTTGCAGAAAGTGAATCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017867.1-852s1c1
Sequence:CCGGGTGCAGTTTGCTAATGATGAACTCGAGTTCATCATTAGCAAACTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017867.1-199s1c1
Sequence:CCGGGTGAAGAACTTGATCCTGAAACTCGAGTTTCAGGATCAAGTTCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017867.1-894s1c1
Sequence:CCGGGAATTGGGAATGGATCTCTTTCTCGAGAAAGAGATCCATTCCCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017867.1-250s1c1
Sequence:CCGGGACTTCAATTAGTTGGTCCTTCTCGAGAAGGACCAACTAATTGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017867.1-796s1c1
Sequence:CCGGCAAGTGATGAGGAGAGACTAACTCGAGTTAGTCTCTCCTCATCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017867.1-795s1c1
Sequence:CCGGGCAAGTGATGAGGAGAGACTACTCGAGTAGTCTCTCCTCATCACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017867.2-244s21c1
Sequence:CCGGGTGAAGAACTTGATCCTGAAACTCGAGTTTCAGGATCAAGTTCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017867.2-268s21c1
Sequence:CCGGCATCTGATTCACTTTCTGCAACTCGAGTTGCAGAAAGTGAATCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017867.2-742s21c1
Sequence:CCGGGCTTGGTTGTTCCAGTAGATACTCGAGTATCTACTGGAACAACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017867.2-840s21c1
Sequence:CCGGGCAAGTGATGAGGAGAGACTACTCGAGTAGTCTCTCCTCATCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017867
VALIDATED
C4orf27 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 27
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_017867.1-626s1c1
Sequence:CCGGGCTTGAACAGAGAACCGTGAACTCGAGTTCACGGTTCTCTGTTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_017867.1-697s1c1
Sequence:CCGGGCTTGGTTGTTCCAGTAGATACTCGAGTATCTACTGGAACAACCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017867.1-365s1c1
Sequence:CCGGCCAGACCATTATTATCGGAGACTCGAGTCTCCGATAATAATGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017867.1-1032s1c1
Sequence:CCGGCAAGAGAACATAGACCAACTTCTCGAGAAGTTGGTCTATGTTCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017867.1-829s1c1
Sequence:CCGGCCATTCAGGAAATGATGACTTCTCGAGAAGTCATCATTTCCTGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017867.1-223s1c1
Sequence:CCGGCATCTGATTCACTTTCTGCAACTCGAGTTGCAGAAAGTGAATCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017867.1-852s1c1
Sequence:CCGGGTGCAGTTTGCTAATGATGAACTCGAGTTCATCATTAGCAAACTGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017867.1-199s1c1
Sequence:CCGGGTGAAGAACTTGATCCTGAAACTCGAGTTTCAGGATCAAGTTCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017867.1-894s1c1
Sequence:CCGGGAATTGGGAATGGATCTCTTTCTCGAGAAAGAGATCCATTCCCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017867.1-250s1c1
Sequence:CCGGGACTTCAATTAGTTGGTCCTTCTCGAGAAGGACCAACTAATTGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017867.1-796s1c1
Sequence:CCGGCAAGTGATGAGGAGAGACTAACTCGAGTTAGTCTCTCCTCATCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017867.1-795s1c1
Sequence:CCGGGCAAGTGATGAGGAGAGACTACTCGAGTAGTCTCTCCTCATCACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017867.2-244s21c1
Sequence:CCGGGTGAAGAACTTGATCCTGAAACTCGAGTTTCAGGATCAAGTTCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017867.2-268s21c1
Sequence:CCGGCATCTGATTCACTTTCTGCAACTCGAGTTGCAGAAAGTGAATCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017867.2-742s21c1
Sequence:CCGGGCTTGGTTGTTCCAGTAGATACTCGAGTATCTACTGGAACAACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017867.2-840s21c1
Sequence:CCGGGCAAGTGATGAGGAGAGACTACTCGAGTAGTCTCTCCTCATCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017867
VALIDATED
C4orf27 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 27
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_017867.1-626s1c1
Sequence:CCGGGCTTGAACAGAGAACCGTGAACTCGAGTTCACGGTTCTCTGTTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_017867.1-697s1c1
Sequence:CCGGGCTTGGTTGTTCCAGTAGATACTCGAGTATCTACTGGAACAACCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_017867.1-365s1c1
Sequence:CCGGCCAGACCATTATTATCGGAGACTCGAGTCTCCGATAATAATGGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017867.1-1032s1c1
Sequence:CCGGCAAGAGAACATAGACCAACTTCTCGAGAAGTTGGTCTATGTTCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017867.1-829s1c1
Sequence:CCGGCCATTCAGGAAATGATGACTTCTCGAGAAGTCATCATTTCCTGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017867.1-223s1c1
Sequence:CCGGCATCTGATTCACTTTCTGCAACTCGAGTTGCAGAAAGTGAATCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017867.1-852s1c1
Sequence:CCGGGTGCAGTTTGCTAATGATGAACTCGAGTTCATCATTAGCAAACTGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_017867.1-199s1c1
Sequence:CCGGGTGAAGAACTTGATCCTGAAACTCGAGTTTCAGGATCAAGTTCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017867.1-894s1c1
Sequence:CCGGGAATTGGGAATGGATCTCTTTCTCGAGAAAGAGATCCATTCCCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017867.1-250s1c1
Sequence:CCGGGACTTCAATTAGTTGGTCCTTCTCGAGAAGGACCAACTAATTGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017867.1-796s1c1
Sequence:CCGGCAAGTGATGAGGAGAGACTAACTCGAGTTAGTCTCTCCTCATCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017867.1-795s1c1
Sequence:CCGGGCAAGTGATGAGGAGAGACTACTCGAGTAGTCTCTCCTCATCACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017867.2-244s21c1
Sequence:CCGGGTGAAGAACTTGATCCTGAAACTCGAGTTTCAGGATCAAGTTCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017867.2-268s21c1
Sequence:CCGGCATCTGATTCACTTTCTGCAACTCGAGTTGCAGAAAGTGAATCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017867.2-742s21c1
Sequence:CCGGGCTTGGTTGTTCCAGTAGATACTCGAGTATCTACTGGAACAACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017867.2-840s21c1
Sequence:CCGGGCAAGTGATGAGGAGAGACTACTCGAGTAGTCTCTCCTCATCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)