EMAIL THIS PAGE TO A FRIEND

C4orf29

chromosome 4 open reading frame 29

22 Gene Product Result for
Species: Human C4orf29(80167)
UniProtKB ID: Q0P651, A1A4W8, A1A4W9, Q9H7A7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039717 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039717 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039717 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025097 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025097 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025097 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120051 MISSION® esiRNA esiRNA human C4orf29 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039717 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138344 predicted 611
2 SASI_Hs01_00138345 predicted 516
3 SASI_Hs01_00138346 predicted 1568
4 SASI_Hs01_00138348 predicted 1282
5 SASI_Hs01_00138349 predicted 1311
6 SASI_Hs01_00138350 predicted 592
7 SASI_Hs01_00138351 predicted 508
8 SASI_Hs01_00138352 predicted 574
9 SASI_Hs01_00138353 predicted 1426
10 SASI_Hs02_00308656 predicted 1072
11 SASI_Hs01_00138347 predicted 1199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039717
C4orf29 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 29
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039717.1-1072s21c1
Sequence:CCGGGACAAGCTAACTAACCTTAATCTCGAGATTAAGGTTAGTTAGCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039717.1-1753s21c1
Sequence:CCGGGAACTAAGCATGATGCATATTCTCGAGAATATGCATCATGCTTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039717.1-660s21c1
Sequence:CCGGTGGAACAGGAGATCATCATTACTCGAGTAATGATGATCTCCTGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039717.1-1432s21c1
Sequence:CCGGGCCAAAGAAGATGCCTATATTCTCGAGAATATAGGCATCTTCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039717.1-1288s21c1
Sequence:CCGGTCATACCACCTACTTAGTAAACTCGAGTTTACTAAGTAGGTGGTATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039717
C4orf29 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 29
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039717.1-1072s21c1
Sequence:CCGGGACAAGCTAACTAACCTTAATCTCGAGATTAAGGTTAGTTAGCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039717.1-1753s21c1
Sequence:CCGGGAACTAAGCATGATGCATATTCTCGAGAATATGCATCATGCTTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039717.1-660s21c1
Sequence:CCGGTGGAACAGGAGATCATCATTACTCGAGTAATGATGATCTCCTGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039717.1-1432s21c1
Sequence:CCGGGCCAAAGAAGATGCCTATATTCTCGAGAATATAGGCATCTTCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039717.1-1288s21c1
Sequence:CCGGTCATACCACCTACTTAGTAAACTCGAGTTTACTAAGTAGGTGGTATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039717
C4orf29 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 29
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039717.1-1072s21c1
Sequence:CCGGGACAAGCTAACTAACCTTAATCTCGAGATTAAGGTTAGTTAGCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039717.1-1753s21c1
Sequence:CCGGGAACTAAGCATGATGCATATTCTCGAGAATATGCATCATGCTTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039717.1-660s21c1
Sequence:CCGGTGGAACAGGAGATCATCATTACTCGAGTAATGATGATCTCCTGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039717.1-1432s21c1
Sequence:CCGGGCCAAAGAAGATGCCTATATTCTCGAGAATATAGGCATCTTCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039717.1-1288s21c1
Sequence:CCGGTCATACCACCTACTTAGTAAACTCGAGTTTACTAAGTAGGTGGTATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025097
C4orf29 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 29
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000129188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025097.1-1319s1c1
Sequence:CCGGCGAACAGGAGTTCGAAGTTTACTCGAGTAAACTTCGAACTCCTGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025097.1-1783s1c1
Sequence:CCGGGCCTGAACATCTGTGGAATAACTCGAGTTATTCCACAGATGTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025097.1-933s1c1
Sequence:CCGGCAGACAAGCTAACTAACCTTACTCGAGTAAGGTTAGTTAGCTTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025097
C4orf29 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 29
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000129188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025097.1-1319s1c1
Sequence:CCGGCGAACAGGAGTTCGAAGTTTACTCGAGTAAACTTCGAACTCCTGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025097.1-1783s1c1
Sequence:CCGGGCCTGAACATCTGTGGAATAACTCGAGTTATTCCACAGATGTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025097.1-933s1c1
Sequence:CCGGCAGACAAGCTAACTAACCTTACTCGAGTAAGGTTAGTTAGCTTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025097
C4orf29 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 29
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000129188    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025097.1-1319s1c1
Sequence:CCGGCGAACAGGAGTTCGAAGTTTACTCGAGTAAACTTCGAACTCCTGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149927    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025097.1-1783s1c1
Sequence:CCGGGCCTGAACATCTGTGGAATAACTCGAGTTATTCCACAGATGTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025097.1-933s1c1
Sequence:CCGGCAGACAAGCTAACTAACCTTACTCGAGTAAGGTTAGTTAGCTTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)