EMAIL THIS PAGE TO A FRIEND

C4orf32

chromosome 4 open reading frame 32

137 Gene Product Result for
Species: Human C4orf32(132720)
UniProtKB ID: Q8N8J7, Q49A91, Q4W5C7, Q8TBF9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152400 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025221 MISSION® esiRNA esiRNA human C4orf32 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152400 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222393 predicted 487
2 SASI_Hs01_00222394 predicted 771
3 SASI_Hs01_00222395 predicted 619
4 SASI_Hs01_00222396 predicted 311
5 SASI_Hs01_00222397 predicted 334
6 SASI_Hs01_00222398 predicted 199
7 SASI_Hs02_00366082 predicted 413
8 SASI_Hs01_00222399 predicted 461
9 SASI_Hs01_00222401 predicted 558
10 SASI_Hs01_00222402 predicted 781
11 SASI_Hs01_00222400 predicted 697
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152400
C4orf32 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 32
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152400.1-343s1c1
Sequence:CCGGGAATAGTGGAACCAGTAATAGCTCGAGCTATTACTGGTTCCACTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152400.1-1871s1c1
Sequence:CCGGGCATTCTTAGTGTCTTCTCATCTCGAGATGAGAAGACACTAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152400.1-408s1c1
Sequence:CCGGCTTGGACTAGTTGCTGTTCTTCTCGAGAAGAACAGCAACTAGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152400.1-414s1c1
Sequence:CCGGCTAGTTGCTGTTCTTTGCCTTCTCGAGAAGGCAAAGAACAGCAACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152400.1-216s1c1
Sequence:CCGGGTTGAAGACTCACAGAACCACCTCGAGGTGGTTCTGTGAGTCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152400.1-210s1c1
Sequence:CCGGCAGGATGTTGAAGACTCACAGCTCGAGCTGTGAGTCTTCAACATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152400.1-2088s1c1
Sequence:CCGGGCCTTTATGAACTCAGTATAACTCGAGTTATACTGAGTTCATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152400.1-900s1c1
Sequence:CCGGCCCACCAAATAATCTCATATTCTCGAGAATATGAGATTATTTGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152400.1-339s1c1
Sequence:CCGGGAACGAATAGTGGAACCAGTACTCGAGTACTGGTTCCACTATTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152400.1-303s1c1
Sequence:CCGGCTTATCAACATGGGCTTCACACTCGAGTGTGAAGCCCATGTTGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152400
C4orf32 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 32
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152400.1-343s1c1
Sequence:CCGGGAATAGTGGAACCAGTAATAGCTCGAGCTATTACTGGTTCCACTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152400.1-1871s1c1
Sequence:CCGGGCATTCTTAGTGTCTTCTCATCTCGAGATGAGAAGACACTAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152400.1-408s1c1
Sequence:CCGGCTTGGACTAGTTGCTGTTCTTCTCGAGAAGAACAGCAACTAGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152400.1-414s1c1
Sequence:CCGGCTAGTTGCTGTTCTTTGCCTTCTCGAGAAGGCAAAGAACAGCAACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152400.1-216s1c1
Sequence:CCGGGTTGAAGACTCACAGAACCACCTCGAGGTGGTTCTGTGAGTCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152400.1-210s1c1
Sequence:CCGGCAGGATGTTGAAGACTCACAGCTCGAGCTGTGAGTCTTCAACATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152400.1-2088s1c1
Sequence:CCGGGCCTTTATGAACTCAGTATAACTCGAGTTATACTGAGTTCATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152400.1-900s1c1
Sequence:CCGGCCCACCAAATAATCTCATATTCTCGAGAATATGAGATTATTTGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152400.1-339s1c1
Sequence:CCGGGAACGAATAGTGGAACCAGTACTCGAGTACTGGTTCCACTATTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152400.1-303s1c1
Sequence:CCGGCTTATCAACATGGGCTTCACACTCGAGTGTGAAGCCCATGTTGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152400
C4orf32 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 32
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145456    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152400.1-343s1c1
Sequence:CCGGGAATAGTGGAACCAGTAATAGCTCGAGCTATTACTGGTTCCACTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144671    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152400.1-1871s1c1
Sequence:CCGGGCATTCTTAGTGTCTTCTCATCTCGAGATGAGAAGACACTAAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152400.1-408s1c1
Sequence:CCGGCTTGGACTAGTTGCTGTTCTTCTCGAGAAGAACAGCAACTAGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142974    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152400.1-414s1c1
Sequence:CCGGCTAGTTGCTGTTCTTTGCCTTCTCGAGAAGGCAAAGAACAGCAACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152400.1-216s1c1
Sequence:CCGGGTTGAAGACTCACAGAACCACCTCGAGGTGGTTCTGTGAGTCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152400.1-210s1c1
Sequence:CCGGCAGGATGTTGAAGACTCACAGCTCGAGCTGTGAGTCTTCAACATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152400.1-2088s1c1
Sequence:CCGGGCCTTTATGAACTCAGTATAACTCGAGTTATACTGAGTTCATAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152400.1-900s1c1
Sequence:CCGGCCCACCAAATAATCTCATATTCTCGAGAATATGAGATTATTTGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152400.1-339s1c1
Sequence:CCGGGAACGAATAGTGGAACCAGTACTCGAGTACTGGTTCCACTATTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152400.1-303s1c1
Sequence:CCGGCTTATCAACATGGGCTTCACACTCGAGTGTGAAGCCCATGTTGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks