EMAIL THIS PAGE TO A FRIEND

C4orf33

chromosome 4 open reading frame 33

UniProtKB ID: Q8N1A6, D3DNY2, Q6PJF3, Q8NBC5
Gene ID:
chicken(422485) chromosome 4 open reading frame, human C4orf33
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA061199 Anti-C4orf33 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV51908 Anti-C4ORF33 antibody produced in rabbit affinity isolated antibody human, rat, horse, rabbit, canine, bovine, mouse, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173487 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173487 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173487 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008681 MISSION® esiRNA esiRNA targeting human C4orf33 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099783 Rosetta Predictions human pricing
NM_173487 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321448 predicted 383
2 SASI_Hs02_00321449 predicted 658
3 SASI_Hs02_00321450 predicted 517
4 SASI_Hs02_00321451 predicted 661
5 SASI_Hs02_00321452 predicted 436
6 SASI_Hs02_00321453 predicted 681
7 SASI_Hs02_00321454 predicted 649
8 SASI_Hs02_00321455 predicted 681
9 SASI_Hs02_00321456 predicted 667
10 SASI_Hs02_00321457 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141315 predicted 659
2 SASI_Hs01_00141309 predicted 923
3 SASI_Hs01_00141310 predicted 792
4 SASI_Hs01_00141312 predicted 937
5 SASI_Hs02_00368247 predicted 709
6 SASI_Hs02_00368248 predicted 953
7 SASI_Hs02_00368249 predicted 928
8 SASI_Hs01_00141314 predicted 947
9 SASI_Hs01_00141316 predicted 937
10 SASI_Hs02_00368250 predicted 922
11 SASI_Hs01_00141308 predicted 342
12 SASI_Hs01_00141311 predicted 735
13 SASI_Hs01_00141313 predicted 395
14 SASI_Hs01_00141317 predicted 347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173487
VALIDATED
C4orf33 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 33
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_173487.1-335s1c1
Sequence:CCGGGTGAAGCATGAGCCCGTATTTCTCGAGAAATACGGGCTCATGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_173487.1-1285s1c1
Sequence:CCGGGACTGCTCATAGCAGCTTTATCTCGAGATAAAGCTGCTATGAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173487.1-833s1c1
Sequence:CCGGCTTGGAGAAGAGTGGAAACAACTCGAGTTGTTTCCACTCTTCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173487.1-734s1c1
Sequence:CCGGGAAGCTCTTTACCCTGTACCTCTCGAGAGGTACAGGGTAAAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173487.1-376s1c1
Sequence:CCGGCAGAGGAGTGATGATGGACATCTCGAGATGTCCATCATCACTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173487.1-839s1c1
Sequence:CCGGGAAGAGTGGAAACAACCGGAACTCGAGTTCCGGTTGTTTCCACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_173487.1-795s1c1
Sequence:CCGGGCCTAGAATACTTCAAGTCTTCTCGAGAAGACTTGAAGTATTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173487.2-522s21c1
Sequence:CCGGTCAATGAACTGTGGGATTATGCTCGAGCATAATCCCACAGTTCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173487.2-661s21c1
Sequence:CCGGAGAACTTCCTTTATCGTTCAGCTCGAGCTGAACGATAAAGGAAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173487.2-828s21c1
Sequence:CCGCATGAACTGCAGCAAGGACAAACTCGAGTTTGTCCTTGCTGCAGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173487.2-565s21c1
Sequence:CCGGGAATGATATAACTGAGCAATACTCGAGTATTGCTCAGTTATATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173487
VALIDATED
C4orf33 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 33
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_173487.1-335s1c1
Sequence:CCGGGTGAAGCATGAGCCCGTATTTCTCGAGAAATACGGGCTCATGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_173487.1-1285s1c1
Sequence:CCGGGACTGCTCATAGCAGCTTTATCTCGAGATAAAGCTGCTATGAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173487.1-833s1c1
Sequence:CCGGCTTGGAGAAGAGTGGAAACAACTCGAGTTGTTTCCACTCTTCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173487.1-734s1c1
Sequence:CCGGGAAGCTCTTTACCCTGTACCTCTCGAGAGGTACAGGGTAAAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173487.1-376s1c1
Sequence:CCGGCAGAGGAGTGATGATGGACATCTCGAGATGTCCATCATCACTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173487.1-839s1c1
Sequence:CCGGGAAGAGTGGAAACAACCGGAACTCGAGTTCCGGTTGTTTCCACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_173487.1-795s1c1
Sequence:CCGGGCCTAGAATACTTCAAGTCTTCTCGAGAAGACTTGAAGTATTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173487.2-522s21c1
Sequence:CCGGTCAATGAACTGTGGGATTATGCTCGAGCATAATCCCACAGTTCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173487.2-661s21c1
Sequence:CCGGAGAACTTCCTTTATCGTTCAGCTCGAGCTGAACGATAAAGGAAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173487.2-828s21c1
Sequence:CCGCATGAACTGCAGCAAGGACAAACTCGAGTTTGTCCTTGCTGCAGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173487.2-565s21c1
Sequence:CCGGGAATGATATAACTGAGCAATACTCGAGTATTGCTCAGTTATATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173487
VALIDATED
C4orf33 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 33
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_173487.1-335s1c1
Sequence:CCGGGTGAAGCATGAGCCCGTATTTCTCGAGAAATACGGGCTCATGCTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_173487.1-1285s1c1
Sequence:CCGGGACTGCTCATAGCAGCTTTATCTCGAGATAAAGCTGCTATGAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143159    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173487.1-833s1c1
Sequence:CCGGCTTGGAGAAGAGTGGAAACAACTCGAGTTGTTTCCACTCTTCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173487.1-734s1c1
Sequence:CCGGGAAGCTCTTTACCCTGTACCTCTCGAGAGGTACAGGGTAAAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173487.1-376s1c1
Sequence:CCGGCAGAGGAGTGATGATGGACATCTCGAGATGTCCATCATCACTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173487.1-839s1c1
Sequence:CCGGGAAGAGTGGAAACAACCGGAACTCGAGTTCCGGTTGTTTCCACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_173487.1-795s1c1
Sequence:CCGGGCCTAGAATACTTCAAGTCTTCTCGAGAAGACTTGAAGTATTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173487.2-522s21c1
Sequence:CCGGTCAATGAACTGTGGGATTATGCTCGAGCATAATCCCACAGTTCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173487.2-661s21c1
Sequence:CCGGAGAACTTCCTTTATCGTTCAGCTCGAGCTGAACGATAAAGGAAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173487.2-828s21c1
Sequence:CCGCATGAACTGCAGCAAGGACAAACTCGAGTTTGTCCTTGCTGCAGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173487.2-565s21c1
Sequence:CCGGGAATGATATAACTGAGCAATACTCGAGTATTGCTCAGTTATATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks