EMAIL THIS PAGE TO A FRIEND

C4orf36

chromosome 4 open reading frame 36

26 Gene Product Result for
Species: Human C4orf36(132989)
UniProtKB ID: Q96KX1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144645 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144645 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196398 predicted 520
2 SASI_Hs01_00196399 predicted 413
3 SASI_Hs02_00364502 predicted 634
4 SASI_Hs01_00196400 predicted 556
5 SASI_Hs01_00196401 predicted 382
6 SASI_Hs01_00196402 predicted 369
7 SASI_Hs01_00196404 predicted 468
8 SASI_Hs01_00196405 predicted 431
9 SASI_Hs01_00196407 predicted 452
10 SASI_Hs02_00364503 predicted 647
11 SASI_Hs01_00196403 predicted 420
12 SASI_Hs01_00196406 predicted 585
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144645
C4orf36 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 36
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144645.3-598s21c1
Sequence:CCGGATCTAAGGAAATTCAGCTTCTCTCGAGAGAAGCTGAATTTCCTTAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144645.3-361s21c1
Sequence:CCGGGGGCAGTTGTTATAATGTACACTCGAGTGTACATTATAACAACTGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144645.3-667s21c1
Sequence:CCGGACACCTGAAGCGCGGATTGTACTCGAGTACAATCCGCGCTTCAGGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144645.1-391s1c1
Sequence:CCGGCTGGTACACAAACCTAGCCAACTCGAGTTGGCTAGGTTTGTGTACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144645.1-619s1c1
Sequence:CCGGGAGAAGACCTCTTCCATCTAACTCGAGTTAGATGGAAGAGGTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144645.1-394s1c1
Sequence:CCGGGTACACAAACCTAGCCAATATCTCGAGATATTGGCTAGGTTTGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144645.1-397s1c1
Sequence:CCGGCACAAACCTAGCCAATATCAACTCGAGTTGATATTGGCTAGGTTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144645.1-362s1c1
Sequence:CCGGCCTTGGGATATTGCATTGCTTCTCGAGAAGCAATGCAATATCCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144645.1-615s1c1
Sequence:CCGGGTTTGAGAAGACCTCTTCCATCTCGAGATGGAAGAGGTCTTCTCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144645
C4orf36 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 36
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144645.3-598s21c1
Sequence:CCGGATCTAAGGAAATTCAGCTTCTCTCGAGAGAAGCTGAATTTCCTTAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144645.3-361s21c1
Sequence:CCGGGGGCAGTTGTTATAATGTACACTCGAGTGTACATTATAACAACTGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144645.3-667s21c1
Sequence:CCGGACACCTGAAGCGCGGATTGTACTCGAGTACAATCCGCGCTTCAGGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144645.1-391s1c1
Sequence:CCGGCTGGTACACAAACCTAGCCAACTCGAGTTGGCTAGGTTTGTGTACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144645.1-619s1c1
Sequence:CCGGGAGAAGACCTCTTCCATCTAACTCGAGTTAGATGGAAGAGGTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144645.1-394s1c1
Sequence:CCGGGTACACAAACCTAGCCAATATCTCGAGATATTGGCTAGGTTTGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144645.1-397s1c1
Sequence:CCGGCACAAACCTAGCCAATATCAACTCGAGTTGATATTGGCTAGGTTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144645.1-362s1c1
Sequence:CCGGCCTTGGGATATTGCATTGCTTCTCGAGAAGCAATGCAATATCCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144645.1-615s1c1
Sequence:CCGGGTTTGAGAAGACCTCTTCCATCTCGAGATGGAAGAGGTCTTCTCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144645
C4orf36 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 36
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144645.3-598s21c1
Sequence:CCGGATCTAAGGAAATTCAGCTTCTCTCGAGAGAAGCTGAATTTCCTTAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144645.3-361s21c1
Sequence:CCGGGGGCAGTTGTTATAATGTACACTCGAGTGTACATTATAACAACTGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144645.3-667s21c1
Sequence:CCGGACACCTGAAGCGCGGATTGTACTCGAGTACAATCCGCGCTTCAGGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144645.1-391s1c1
Sequence:CCGGCTGGTACACAAACCTAGCCAACTCGAGTTGGCTAGGTTTGTGTACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144645.1-619s1c1
Sequence:CCGGGAGAAGACCTCTTCCATCTAACTCGAGTTAGATGGAAGAGGTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144645.1-394s1c1
Sequence:CCGGGTACACAAACCTAGCCAATATCTCGAGATATTGGCTAGGTTTGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144645.1-397s1c1
Sequence:CCGGCACAAACCTAGCCAATATCAACTCGAGTTGATATTGGCTAGGTTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144645.1-362s1c1
Sequence:CCGGCCTTGGGATATTGCATTGCTTCTCGAGAAGCAATGCAATATCCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144645.1-615s1c1
Sequence:CCGGGTTTGAGAAGACCTCTTCCATCTCGAGATGGAAGAGGTCTTCTCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)