EMAIL THIS PAGE TO A FRIEND

C4orf3

chromosome 4 open reading frame 3

19 Gene Product Result for
Species: Human C4orf3(401152)
UniProtKB ID: Q8WVX3, Q6J203
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001701 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035161 MISSION® esiRNA esiRNA human AC092656.1-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001701 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122919 predicted 842
2 SASI_Hs01_00122920 predicted 639
3 SASI_Hs01_00122922 predicted 657
4 SASI_Hs01_00122923 predicted 478
5 SASI_Hs02_00303888 predicted 635
6 SASI_Hs02_00303889 predicted 501
7 SASI_Hs02_00303890 predicted 527
8 SASI_Hs02_00303891 predicted 772
9 SASI_Hs01_00122926 predicted 814
10 SASI_Hs01_00122927 predicted 823
11 SASI_Hs01_00122918 predicted 380
12 SASI_Hs01_00122921 predicted 333
13 SASI_Hs01_00122924 predicted 300
14 SASI_Hs01_00122925 predicted 608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001701
VALIDATED
C4orf3 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001701.1-263s1c1
Sequence:CCGGCGATGTGGTGGTGTTTCTCTTCTCGAGAAGAGAAACACCACCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168526    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001701.1-850s1c1
Sequence:CCGGCGACAGGTTGATACAGTCTTACTCGAGTAAGACTGTATCAACCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001001701.1-270s1c1
Sequence:CCGGGTGGTGTTTCTCTTTGTGTATCTCGAGATACACAAAGAGAAACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167321    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001701.1-1062s1c1
Sequence:CCGGCTTGCTTAAATACTTCAGCAACTCGAGTTGCTGAAGTATTTAAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167487    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001701.1-579s1c1
Sequence:CCGGGCATTTGTACTTAAAGGTCTTCTCGAGAAGACCTTTAAGTACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001701.1-664s1c1
Sequence:CCGGGATGCAAGTAATAGGATGATTCTCGAGAATCATCCTATTACTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001701.3-347s21c1
Sequence:CCGGAGGGAGGCAGAACTTCGATGTCTCGAGACATCGAAGTTCTGCCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001001701.3-385s21c1
Sequence:CCGGCAAATGGGCTTCCCAAACACTCTCGAGAGTGTTTGGGAAGCCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001701.3-396s21c1
Sequence:CCGGCCCAAACACTCCTACTGGTTGCTCGAGCAACCAGTAGGAGTGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001701.3-474s21c1
Sequence:CCGGCCATGACTTGTTCGCTGATATCTCGAGATATCAGCGAACAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001001701.3-626s21c1
Sequence:CCGGCTAATTTGCAGAACTCTATTACTCGAGTAATAGAGTTCTGCAAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001701.3-409s21c1
Sequence:CCGGACTGGTTGGACCTCTGGCTTTCTCGAGAAAGCCAGAGGTCCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001701.3-640s21c1
Sequence:CCGGTCTATTAATTGGGTAGGATTTCTCGAGAAATCCTACCCAATTAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001701
VALIDATED
C4orf3 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001701.1-263s1c1
Sequence:CCGGCGATGTGGTGGTGTTTCTCTTCTCGAGAAGAGAAACACCACCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168526    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001701.1-850s1c1
Sequence:CCGGCGACAGGTTGATACAGTCTTACTCGAGTAAGACTGTATCAACCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001001701.1-270s1c1
Sequence:CCGGGTGGTGTTTCTCTTTGTGTATCTCGAGATACACAAAGAGAAACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167321    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001701.1-1062s1c1
Sequence:CCGGCTTGCTTAAATACTTCAGCAACTCGAGTTGCTGAAGTATTTAAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167487    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001701.1-579s1c1
Sequence:CCGGGCATTTGTACTTAAAGGTCTTCTCGAGAAGACCTTTAAGTACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001701.1-664s1c1
Sequence:CCGGGATGCAAGTAATAGGATGATTCTCGAGAATCATCCTATTACTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001701.3-347s21c1
Sequence:CCGGAGGGAGGCAGAACTTCGATGTCTCGAGACATCGAAGTTCTGCCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001001701.3-385s21c1
Sequence:CCGGCAAATGGGCTTCCCAAACACTCTCGAGAGTGTTTGGGAAGCCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001701.3-396s21c1
Sequence:CCGGCCCAAACACTCCTACTGGTTGCTCGAGCAACCAGTAGGAGTGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001701.3-474s21c1
Sequence:CCGGCCATGACTTGTTCGCTGATATCTCGAGATATCAGCGAACAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001001701.3-626s21c1
Sequence:CCGGCTAATTTGCAGAACTCTATTACTCGAGTAATAGAGTTCTGCAAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001701.3-409s21c1
Sequence:CCGGACTGGTTGGACCTCTGGCTTTCTCGAGAAAGCCAGAGGTCCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001701.3-640s21c1
Sequence:CCGGTCTATTAATTGGGTAGGATTTCTCGAGAAATCCTACCCAATTAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001701
VALIDATED
C4orf3 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001701.1-263s1c1
Sequence:CCGGCGATGTGGTGGTGTTTCTCTTCTCGAGAAGAGAAACACCACCACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168526    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001701.1-850s1c1
Sequence:CCGGCGACAGGTTGATACAGTCTTACTCGAGTAAGACTGTATCAACCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001001701.1-270s1c1
Sequence:CCGGGTGGTGTTTCTCTTTGTGTATCTCGAGATACACAAAGAGAAACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167321    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001701.1-1062s1c1
Sequence:CCGGCTTGCTTAAATACTTCAGCAACTCGAGTTGCTGAAGTATTTAAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167487    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001701.1-579s1c1
Sequence:CCGGGCATTTGTACTTAAAGGTCTTCTCGAGAAGACCTTTAAGTACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167662    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001701.1-664s1c1
Sequence:CCGGGATGCAAGTAATAGGATGATTCTCGAGAATCATCCTATTACTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001701.3-347s21c1
Sequence:CCGGAGGGAGGCAGAACTTCGATGTCTCGAGACATCGAAGTTCTGCCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001001701.3-385s21c1
Sequence:CCGGCAAATGGGCTTCCCAAACACTCTCGAGAGTGTTTGGGAAGCCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001701.3-396s21c1
Sequence:CCGGCCCAAACACTCCTACTGGTTGCTCGAGCAACCAGTAGGAGTGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001701.3-474s21c1
Sequence:CCGGCCATGACTTGTTCGCTGATATCTCGAGATATCAGCGAACAAGTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001001701.3-626s21c1
Sequence:CCGGCTAATTTGCAGAACTCTATTACTCGAGTAATAGAGTTCTGCAAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001701.3-409s21c1
Sequence:CCGGACTGGTTGGACCTCTGGCTTTCTCGAGAAAGCCAGAGGTCCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001701.3-640s21c1
Sequence:CCGGTCTATTAATTGGGTAGGATTTCTCGAGAAATCCTACCCAATTAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks