EMAIL THIS PAGE TO A FRIEND

C4orf40

chromosome 4 open reading frame 40

20 Gene Product Result for
Species: Human C4orf40(401137)
UniProtKB ID: Q6MZM9, A8MXP0, Q6MZR6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376322 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_214711 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_214711 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_214711 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_214711 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_214711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374394 predicted 292
2 SASI_Hs01_00053784 predicted 437
3 SASI_Hs01_00053781 predicted 462
4 SASI_Hs02_00374395 predicted 940
5 SASI_Hs02_00374396 predicted 963
6 SASI_Hs02_00374397 predicted 949
7 SASI_Hs01_00053776 predicted 279
8 SASI_Hs01_00053782 predicted 838
9 SASI_Hs01_00053783 predicted 337
10 SASI_Hs01_00053777 predicted 262
11 SASI_Hs01_00053775 predicted 254
12 SASI_Hs01_00053778 predicted 237
13 SASI_Hs01_00053779 predicted 281
14 SASI_Hs01_00053780 predicted 225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376322
C4orf40 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 40
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000130199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376322.1-2286s1c1
Sequence:CCGGCCCTCATCTTATCTCCACAAACTCGAGTTTGTGGAGATAAGATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376322.1-266s1c1
Sequence:CCGGCGGAATTTACCACCTCCTCTTCTCGAGAAGAGGAGGTGGTAAATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376322.1-2285s1c1
Sequence:CCGGGCCCTCATCTTATCTCCACAACTCGAGTTGTGGAGATAAGATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376322
C4orf40 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 40
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000130199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376322.1-2286s1c1
Sequence:CCGGCCCTCATCTTATCTCCACAAACTCGAGTTTGTGGAGATAAGATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376322.1-266s1c1
Sequence:CCGGCGGAATTTACCACCTCCTCTTCTCGAGAAGAGGAGGTGGTAAATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376322.1-2285s1c1
Sequence:CCGGGCCCTCATCTTATCTCCACAACTCGAGTTGTGGAGATAAGATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376322
C4orf40 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 40
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000130199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376322.1-2286s1c1
Sequence:CCGGCCCTCATCTTATCTCCACAAACTCGAGTTTGTGGAGATAAGATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376322.1-266s1c1
Sequence:CCGGCGGAATTTACCACCTCCTCTTCTCGAGAAGAGGAGGTGGTAAATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_376322.1-2285s1c1
Sequence:CCGGGCCCTCATCTTATCTCCACAACTCGAGTTGTGGAGATAAGATGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_214711
C4orf40 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 40
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000148900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_214711.1-420s1c1
Sequence:CCGGCCCTTAGCTACTCAGTTGAATCTCGAGATTCAACTGAGTAGCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_214711.1-2083s1c1
Sequence:CCGGCCCTGATGTATGAATGACTAACTCGAGTTAGTCATTCATACATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_214711.3-1155s21c1
Sequence:CCGGTATAGGATGATGTTAGTATTGCTCGAGCAATACTAACATCATCCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_214711.3-370s21c1
Sequence:CCGGAGTTACCCTGGGAATACTTACCTCGAGGTAAGTATTCCCAGGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_214711
C4orf40 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 40
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000148900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_214711.1-420s1c1
Sequence:CCGGCCCTTAGCTACTCAGTTGAATCTCGAGATTCAACTGAGTAGCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_214711.1-2083s1c1
Sequence:CCGGCCCTGATGTATGAATGACTAACTCGAGTTAGTCATTCATACATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_214711.3-1155s21c1
Sequence:CCGGTATAGGATGATGTTAGTATTGCTCGAGCAATACTAACATCATCCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_214711.3-370s21c1
Sequence:CCGGAGTTACCCTGGGAATACTTACCTCGAGGTAAGTATTCCCAGGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_214711
C4orf40 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 40
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000148900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_214711.1-420s1c1
Sequence:CCGGCCCTTAGCTACTCAGTTGAATCTCGAGATTCAACTGAGTAGCTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_214711.1-2083s1c1
Sequence:CCGGCCCTGATGTATGAATGACTAACTCGAGTTAGTCATTCATACATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430259    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_214711.3-1155s21c1
Sequence:CCGGTATAGGATGATGTTAGTATTGCTCGAGCAATACTAACATCATCCTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_214711.3-370s21c1
Sequence:CCGGAGTTACCCTGGGAATACTTACCTCGAGGTAAGTATTCCCAGGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks