EMAIL THIS PAGE TO A FRIEND

C4orf45

chromosome 4 open reading frame 45

Species: Human C4orf45(152940)
UniProtKB ID: Q96LM5, A8MPU3, C9J0T8
Gene ID:
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302144 ANTI-C4ORF45 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152543 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152543 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152543 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152543 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152543 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218489 predicted 519
2 SASI_Hs01_00218490 predicted 318
3 SASI_Hs01_00218493 predicted 446
4 SASI_Hs01_00218495 predicted 536
5 SASI_Hs02_00366344 predicted 543
6 SASI_Hs01_00218497 predicted 199
7 SASI_Hs01_00218498 predicted 549
8 SASI_Hs02_00366345 predicted 590
9 SASI_Hs02_00366346 predicted 293
10 SASI_Hs02_00366347 predicted 235
11 SASI_Hs01_00218491 predicted 306
12 SASI_Hs01_00218492 predicted 354
13 SASI_Hs01_00218494 predicted 364
14 SASI_Hs01_00218496 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152543
C4orf45 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 45
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152543.2-207s21c1
Sequence:CCGGGAGAACAGCATCTGGCGTTAGCTCGAGCTAACGCCAGATGCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152543.2-143s21c1
Sequence:CCGGTTTACAGGTCCAGACTACATACTCGAGTATGTAGTCTGGACCTGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152543.2-398s21c1
Sequence:CCGGCAAGCTTCTCTTGATTCAATACTCGAGTATTGAATCAAGAGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152543.2-584s21c1
Sequence:CCGGAGAGCTTCCAAACCACCTAAGCTCGAGCTTAGGTGGTTTGGAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152543.1-517s1c1
Sequence:CCGGCGAGGACACTGATCAGAGAAACTCGAGTTTCTCTGATCAGTGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152543.1-655s1c1
Sequence:CCGGCAGCATAACTCAACCTGCTTTCTCGAGAAAGCAGGTTGAGTTATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152543.1-540s1c1
Sequence:CCGGCCAAATGGGCTATTCTTGTTACTCGAGTAACAAGAATAGCCCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152543.1-523s1c1
Sequence:CCGGCACTGATCAGAGAAATTCCAACTCGAGTTGGAATTTCTCTGATCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152543.1-318s1c1
Sequence:CCGGGTTGGAGAATACCACAGTATACTCGAGTATACTGTGGTATTCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152543.1-396s1c1
Sequence:CCGGGTCAAGCTTCTCTTGATTCAACTCGAGTTGAATCAAGAGAAGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152543.1-532s1c1
Sequence:CCGGGAGAAATTCCAAATGGGCTATCTCGAGATAGCCCATTTGGAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152543
C4orf45 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 45
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152543.2-207s21c1
Sequence:CCGGGAGAACAGCATCTGGCGTTAGCTCGAGCTAACGCCAGATGCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152543.2-143s21c1
Sequence:CCGGTTTACAGGTCCAGACTACATACTCGAGTATGTAGTCTGGACCTGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152543.2-398s21c1
Sequence:CCGGCAAGCTTCTCTTGATTCAATACTCGAGTATTGAATCAAGAGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152543.2-584s21c1
Sequence:CCGGAGAGCTTCCAAACCACCTAAGCTCGAGCTTAGGTGGTTTGGAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152543.1-517s1c1
Sequence:CCGGCGAGGACACTGATCAGAGAAACTCGAGTTTCTCTGATCAGTGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152543.1-655s1c1
Sequence:CCGGCAGCATAACTCAACCTGCTTTCTCGAGAAAGCAGGTTGAGTTATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152543.1-540s1c1
Sequence:CCGGCCAAATGGGCTATTCTTGTTACTCGAGTAACAAGAATAGCCCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152543.1-523s1c1
Sequence:CCGGCACTGATCAGAGAAATTCCAACTCGAGTTGGAATTTCTCTGATCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152543.1-318s1c1
Sequence:CCGGGTTGGAGAATACCACAGTATACTCGAGTATACTGTGGTATTCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152543.1-396s1c1
Sequence:CCGGGTCAAGCTTCTCTTGATTCAACTCGAGTTGAATCAAGAGAAGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152543.1-532s1c1
Sequence:CCGGGAGAAATTCCAAATGGGCTATCTCGAGATAGCCCATTTGGAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152543
C4orf45 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 45
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152543.2-207s21c1
Sequence:CCGGGAGAACAGCATCTGGCGTTAGCTCGAGCTAACGCCAGATGCTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152543.2-143s21c1
Sequence:CCGGTTTACAGGTCCAGACTACATACTCGAGTATGTAGTCTGGACCTGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152543.2-398s21c1
Sequence:CCGGCAAGCTTCTCTTGATTCAATACTCGAGTATTGAATCAAGAGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152543.2-584s21c1
Sequence:CCGGAGAGCTTCCAAACCACCTAAGCTCGAGCTTAGGTGGTTTGGAAGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152543.1-517s1c1
Sequence:CCGGCGAGGACACTGATCAGAGAAACTCGAGTTTCTCTGATCAGTGTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152543.1-655s1c1
Sequence:CCGGCAGCATAACTCAACCTGCTTTCTCGAGAAAGCAGGTTGAGTTATGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152543.1-540s1c1
Sequence:CCGGCCAAATGGGCTATTCTTGTTACTCGAGTAACAAGAATAGCCCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152543.1-523s1c1
Sequence:CCGGCACTGATCAGAGAAATTCCAACTCGAGTTGGAATTTCTCTGATCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152543.1-318s1c1
Sequence:CCGGGTTGGAGAATACCACAGTATACTCGAGTATACTGTGGTATTCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152543.1-396s1c1
Sequence:CCGGGTCAAGCTTCTCTTGATTCAACTCGAGTTGAATCAAGAGAAGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152543.1-532s1c1
Sequence:CCGGGAGAAATTCCAAATGGGCTATCTCGAGATAGCCCATTTGGAATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks