EMAIL THIS PAGE TO A FRIEND

C4orf46

chromosome 4 open reading frame 46

21 Gene Product Result for
Species: Human C4orf46(201725)
UniProtKB ID: Q504U0, B3KNH7
Gene ID:
Human(201725) Summary: This gene encodes a small, conserved protein of unknown function that is expressed in a variety of tissues. There are pseudogenes for this gene on chromosomes 6, 8, 16, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008393 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103201 MISSION® esiRNA esiRNA human C4orf46 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008393 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233231 predicted 769
2 SASI_Hs02_00305424 predicted 737
3 SASI_Hs01_00233234 predicted 687
4 SASI_Hs02_00305425 predicted 588
5 SASI_Hs01_00233235 predicted 773
6 SASI_Hs01_00233236 predicted 595
7 SASI_Hs01_00233237 predicted 660
8 SASI_Hs01_00233238 predicted 616
9 SASI_Hs02_00305426 predicted 591
10 SASI_Hs02_00305427 predicted 658
11 SASI_Hs01_00233232 predicted 437
12 SASI_Hs01_00233233 predicted 787
13 SASI_Hs01_00233239 predicted 398
14 SASI_Hs01_00233240 predicted 471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008393
VALIDATED
C4orf46 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 46
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-451s1c1
Sequence:CCGGGCAGTATCAGCTCAAGTGGAACTCGAGTTCCACTTGAGCTGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-454s1c1
Sequence:CCGGGTATCAGCTCAAGTGGAAGAACTCGAGTTCTTCCACTTGAGCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-475s1c1
Sequence:CCGGCTTGCCTTCAAATGTACAGAACTCGAGTTCTGTACATTTGAAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-535s1c1
Sequence:CCGGGAAGGCTATGATTCTTTGAAACTCGAGTTTCAAAGAATCATAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008393.1-1373s1c1
Sequence:CCGGGCAGTTTAACAGTGTTTGTATCTCGAGATACAAACACTGTTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008393.1-915s1c1
Sequence:CCGGGCAGACTTTGAAGTTGCGTTTCTCGAGAAACGCAACTTCAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-428s1c1
Sequence:CCGGCCAAACTTCTTGAAGCCACATCTCGAGATGTGGCTTCAAGAAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-461s1c1
Sequence:CCGGCTCAAGTGGAAGAACTTGCCTCTCGAGAGGCAAGTTCTTCCACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-574s21c1
Sequence:CCGGTTGAAACCTGATGACTGATTTCTCGAGAAATCAGTCATCAGGTTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-745s21c1
Sequence:CCGGAGCAGAATACCGATGCTATTTCTCGAGAAATAGCATCGGTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008393.2-592s21c1
Sequence:CCGGTTTGGCATACTTCGTTGTTTACTCGAGTAAACAACGAAGTATGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-583s21c1
Sequence:CCGGGATGACTGATTTGGCATACTTCTCGAGAAGTATGCCAAATCAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-551s21c1
Sequence:CCGGTCTTGAAAGAAGGCTATGATTCTCGAGAATCATAGCCTTCTTTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-844s21c1
Sequence:CCGGTTCATCAATAGACGGTTAATACTCGAGTATTAACCGTCTATTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-1021s21c1
Sequence:CCGGCTAAGTTGTCTACAGCTAATGCTCGAGCATTAGCTGTAGACAACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-892s21c1
Sequence:CCGGCAAACTAGGTAGACCATTATTCTCGAGAATAATGGTCTACCTAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008393
VALIDATED
C4orf46 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 46
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-451s1c1
Sequence:CCGGGCAGTATCAGCTCAAGTGGAACTCGAGTTCCACTTGAGCTGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-454s1c1
Sequence:CCGGGTATCAGCTCAAGTGGAAGAACTCGAGTTCTTCCACTTGAGCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-475s1c1
Sequence:CCGGCTTGCCTTCAAATGTACAGAACTCGAGTTCTGTACATTTGAAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-535s1c1
Sequence:CCGGGAAGGCTATGATTCTTTGAAACTCGAGTTTCAAAGAATCATAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008393.1-1373s1c1
Sequence:CCGGGCAGTTTAACAGTGTTTGTATCTCGAGATACAAACACTGTTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008393.1-915s1c1
Sequence:CCGGGCAGACTTTGAAGTTGCGTTTCTCGAGAAACGCAACTTCAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-428s1c1
Sequence:CCGGCCAAACTTCTTGAAGCCACATCTCGAGATGTGGCTTCAAGAAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-461s1c1
Sequence:CCGGCTCAAGTGGAAGAACTTGCCTCTCGAGAGGCAAGTTCTTCCACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-574s21c1
Sequence:CCGGTTGAAACCTGATGACTGATTTCTCGAGAAATCAGTCATCAGGTTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-745s21c1
Sequence:CCGGAGCAGAATACCGATGCTATTTCTCGAGAAATAGCATCGGTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008393.2-592s21c1
Sequence:CCGGTTTGGCATACTTCGTTGTTTACTCGAGTAAACAACGAAGTATGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-583s21c1
Sequence:CCGGGATGACTGATTTGGCATACTTCTCGAGAAGTATGCCAAATCAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-551s21c1
Sequence:CCGGTCTTGAAAGAAGGCTATGATTCTCGAGAATCATAGCCTTCTTTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-844s21c1
Sequence:CCGGTTCATCAATAGACGGTTAATACTCGAGTATTAACCGTCTATTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-1021s21c1
Sequence:CCGGCTAAGTTGTCTACAGCTAATGCTCGAGCATTAGCTGTAGACAACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-892s21c1
Sequence:CCGGCAAACTAGGTAGACCATTATTCTCGAGAATAATGGTCTACCTAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008393
VALIDATED
C4orf46 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 46
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-451s1c1
Sequence:CCGGGCAGTATCAGCTCAAGTGGAACTCGAGTTCCACTTGAGCTGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-454s1c1
Sequence:CCGGGTATCAGCTCAAGTGGAAGAACTCGAGTTCTTCCACTTGAGCTGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-475s1c1
Sequence:CCGGCTTGCCTTCAAATGTACAGAACTCGAGTTCTGTACATTTGAAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-535s1c1
Sequence:CCGGGAAGGCTATGATTCTTTGAAACTCGAGTTTCAAAGAATCATAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008393.1-1373s1c1
Sequence:CCGGGCAGTTTAACAGTGTTTGTATCTCGAGATACAAACACTGTTAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163116    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008393.1-915s1c1
Sequence:CCGGGCAGACTTTGAAGTTGCGTTTCTCGAGAAACGCAACTTCAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-428s1c1
Sequence:CCGGCCAAACTTCTTGAAGCCACATCTCGAGATGTGGCTTCAAGAAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164814    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008393.1-461s1c1
Sequence:CCGGCTCAAGTGGAAGAACTTGCCTCTCGAGAGGCAAGTTCTTCCACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-574s21c1
Sequence:CCGGTTGAAACCTGATGACTGATTTCTCGAGAAATCAGTCATCAGGTTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-745s21c1
Sequence:CCGGAGCAGAATACCGATGCTATTTCTCGAGAAATAGCATCGGTATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008393.2-592s21c1
Sequence:CCGGTTTGGCATACTTCGTTGTTTACTCGAGTAAACAACGAAGTATGCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-583s21c1
Sequence:CCGGGATGACTGATTTGGCATACTTCTCGAGAAGTATGCCAAATCAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-551s21c1
Sequence:CCGGTCTTGAAAGAAGGCTATGATTCTCGAGAATCATAGCCTTCTTTCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365645    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-844s21c1
Sequence:CCGGTTCATCAATAGACGGTTAATACTCGAGTATTAACCGTCTATTGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-1021s21c1
Sequence:CCGGCTAAGTTGTCTACAGCTAATGCTCGAGCATTAGCTGTAGACAACTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365573    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008393.2-892s21c1
Sequence:CCGGCAAACTAGGTAGACCATTATTCTCGAGAATAATGGTCTACCTAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks