EMAIL THIS PAGE TO A FRIEND

C4orf47

chromosome 4 open reading frame 47

18 Gene Product Result for
Species: Human C4orf47(441054)
UniProtKB ID: A7E2U8, Q5BLP7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001114357 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001114357 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001114357 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103661 MISSION® esiRNA esiRNA human C4orf47 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114357 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326524 predicted 559
2 SASI_Hs02_00326525 predicted 508
3 SASI_Hs02_00326526 predicted 745
4 SASI_Hs02_00326527 predicted 555
5 SASI_Hs02_00326528 predicted 566
6 SASI_Hs02_00326529 predicted 578
7 SASI_Hs02_00326530 predicted 651
8 SASI_Hs02_00326531 predicted 651
9 SASI_Hs02_00326532 predicted 747
10 SASI_Hs02_00326533 predicted 740
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001114357
C4orf47 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 47
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114357.1-655s21c1
Sequence:CCGGGAATCTTTACCACCAATTAAACTCGAGTTTAATTGGTGGTAAAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114357.1-563s21c1
Sequence:CCGGATGAAGAGCACCATCGTTTACCTCGAGGTAAACGATGGTGCTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114357.1-259s21c1
Sequence:CCGGCAAGTGAGGAGACGGGATATGCTCGAGCATATCCCGTCTCCTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114357.1-186s21c1
Sequence:CCGGAGATCTTCAGGCAGGTTATTTCTCGAGAAATAACCTGCCTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114357.1-786s21c1
Sequence:CCGGTGACCCTTATGTGGCTAAATTCTCGAGAATTTAGCCACATAAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001114357
C4orf47 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 47
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114357.1-655s21c1
Sequence:CCGGGAATCTTTACCACCAATTAAACTCGAGTTTAATTGGTGGTAAAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114357.1-563s21c1
Sequence:CCGGATGAAGAGCACCATCGTTTACCTCGAGGTAAACGATGGTGCTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114357.1-259s21c1
Sequence:CCGGCAAGTGAGGAGACGGGATATGCTCGAGCATATCCCGTCTCCTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114357.1-186s21c1
Sequence:CCGGAGATCTTCAGGCAGGTTATTTCTCGAGAAATAACCTGCCTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114357.1-786s21c1
Sequence:CCGGTGACCCTTATGTGGCTAAATTCTCGAGAATTTAGCCACATAAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001114357
C4orf47 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 47
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114357.1-655s21c1
Sequence:CCGGGAATCTTTACCACCAATTAAACTCGAGTTTAATTGGTGGTAAAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114357.1-563s21c1
Sequence:CCGGATGAAGAGCACCATCGTTTACCTCGAGGTAAACGATGGTGCTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114357.1-259s21c1
Sequence:CCGGCAAGTGAGGAGACGGGATATGCTCGAGCATATCCCGTCTCCTCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114357.1-186s21c1
Sequence:CCGGAGATCTTCAGGCAGGTTATTTCTCGAGAAATAACCTGCCTGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114357.1-786s21c1
Sequence:CCGGTGACCCTTATGTGGCTAAATTCTCGAGAATTTAGCCACATAAGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks