EMAIL THIS PAGE TO A FRIEND

C4orf50

chromosome 4 open reading frame 50

33 Gene Product Result for
Species: Human C4orf50(389197)
UniProtKB ID: Q6ZRC1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207405 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053551 MISSION® esiRNA esiRNA human AC105915.5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207405 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172746 predicted 518
2 SASI_Hs01_00172747 predicted 613
3 SASI_Hs02_00374017 predicted 940
4 SASI_Hs01_00172748 predicted 634
5 SASI_Hs01_00172749 predicted 822
6 SASI_Hs01_00172750 predicted 870
7 SASI_Hs01_00172751 predicted 508
8 SASI_Hs01_00172752 predicted 941
9 SASI_Hs01_00172754 predicted 871
10 SASI_Hs01_00172755 predicted 740
11 SASI_Hs01_00172753 predicted 346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207405
C4orf50 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 50
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207405.1-1394s21c1
Sequence:CCGGAGTCCAGGACGGATCTCATAGCTCGAGCTATGAGATCCGTCCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207405.1-1007s21c1
Sequence:CCGGAGCAATCAGAGCCCTCATTTACTCGAGTAAATGAGGGCTCTGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-564s1c1
Sequence:CCGGGAATCCTGAAATGGACAGTGTCTCGAGACACTGTCCATTTCAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-554s1c1
Sequence:CCGGCATACCTCTTGAATCCTGAAACTCGAGTTTCAGGATTCAAGAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-536s1c1
Sequence:CCGGCAGCTTTAAGAGCTCAGACATCTCGAGATGTCTGAGCTCTTAAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-852s1c1
Sequence:CCGGCCAAGAGCTTAGACAAAGCATCTCGAGATGCTTTGTCTAAGCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-891s1c1
Sequence:CCGGCCATAAATCACCGCTGGAGTTCTCGAGAACTCCAGCGGTGATTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-651s1c1
Sequence:CCGGCCAACTGGATTCTCTGAAGCTCTCGAGAGCTTCAGAGAATCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172287    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207405.1-1102s1c1
Sequence:CCGGCCTGGCAAATTCTGAGGAGTTCTCGAGAACTCCTCAGAATTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-593s1c1
Sequence:CCGGGCTCATTGTCTTCAGAGTCCTCTCGAGAGGACTCTGAAGACAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207405
C4orf50 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 50
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207405.1-1394s21c1
Sequence:CCGGAGTCCAGGACGGATCTCATAGCTCGAGCTATGAGATCCGTCCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207405.1-1007s21c1
Sequence:CCGGAGCAATCAGAGCCCTCATTTACTCGAGTAAATGAGGGCTCTGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-564s1c1
Sequence:CCGGGAATCCTGAAATGGACAGTGTCTCGAGACACTGTCCATTTCAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-554s1c1
Sequence:CCGGCATACCTCTTGAATCCTGAAACTCGAGTTTCAGGATTCAAGAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-536s1c1
Sequence:CCGGCAGCTTTAAGAGCTCAGACATCTCGAGATGTCTGAGCTCTTAAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-852s1c1
Sequence:CCGGCCAAGAGCTTAGACAAAGCATCTCGAGATGCTTTGTCTAAGCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-891s1c1
Sequence:CCGGCCATAAATCACCGCTGGAGTTCTCGAGAACTCCAGCGGTGATTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-651s1c1
Sequence:CCGGCCAACTGGATTCTCTGAAGCTCTCGAGAGCTTCAGAGAATCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172287    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207405.1-1102s1c1
Sequence:CCGGCCTGGCAAATTCTGAGGAGTTCTCGAGAACTCCTCAGAATTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-593s1c1
Sequence:CCGGGCTCATTGTCTTCAGAGTCCTCTCGAGAGGACTCTGAAGACAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207405
C4orf50 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 50
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207405.1-1394s21c1
Sequence:CCGGAGTCCAGGACGGATCTCATAGCTCGAGCTATGAGATCCGTCCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207405.1-1007s21c1
Sequence:CCGGAGCAATCAGAGCCCTCATTTACTCGAGTAAATGAGGGCTCTGATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-564s1c1
Sequence:CCGGGAATCCTGAAATGGACAGTGTCTCGAGACACTGTCCATTTCAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167197    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-554s1c1
Sequence:CCGGCATACCTCTTGAATCCTGAAACTCGAGTTTCAGGATTCAAGAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-536s1c1
Sequence:CCGGCAGCTTTAAGAGCTCAGACATCTCGAGATGTCTGAGCTCTTAAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-852s1c1
Sequence:CCGGCCAAGAGCTTAGACAAAGCATCTCGAGATGCTTTGTCTAAGCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-891s1c1
Sequence:CCGGCCATAAATCACCGCTGGAGTTCTCGAGAACTCCAGCGGTGATTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172472    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-651s1c1
Sequence:CCGGCCAACTGGATTCTCTGAAGCTCTCGAGAGCTTCAGAGAATCCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172287    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207405.1-1102s1c1
Sequence:CCGGCCTGGCAAATTCTGAGGAGTTCTCGAGAACTCCTCAGAATTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207405.1-593s1c1
Sequence:CCGGGCTCATTGTCTTCAGAGTCCTCTCGAGAGGACTCTGAAGACAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks