EMAIL THIS PAGE TO A FRIEND

C4orf51

chromosome 4 open reading frame 51

25 Gene Product Result for
Species: Human C4orf51(646603)
UniProtKB ID: C9J302
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080531 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080531 Rosetta Predictions human pricing
XM_929540 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315747 predicted 316
2 SASI_Hs02_00315748 predicted 308
3 SASI_Hs02_00315749 predicted 585
4 SASI_Hs02_00315750 predicted 480
5 SASI_Hs02_00315751 predicted 208
6 SASI_Hs02_00315752 predicted 443
7 SASI_Hs02_00315753 predicted 530
8 SASI_Hs02_00315754 predicted 334
9 SASI_Hs02_00315755 predicted 475
10 SASI_Hs02_00315756 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279391 predicted 350
2 SASI_Hs01_00279392 predicted 301
3 SASI_Hs01_00279393 predicted 334
4 SASI_Hs01_00279394 predicted 333
5 SASI_Hs01_00279395 predicted 339
6 SASI_Hs01_00279396 predicted 257
7 SASI_Hs01_00279397 predicted 330
8 SASI_Hs01_00279398 predicted 290
9 SASI_Hs01_00279399 predicted 299
10 SASI_Hs01_00279400 predicted 265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080531
C4orf51 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 51
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080531.1-306s21c1
Sequence:CCGGAGGACTATTCCCTGATATAACCTCGAGGTTATATCAGGGAATAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080531.1-637s21c1
Sequence:CCGGGGCGTGGAGTTTGCTTAATAACTCGAGTTATTAAGCAAACTCCACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080531.1-557s21c1
Sequence:CCGGCTGATCGATACTCCGATTATGCTCGAGCATAATCGGAGTATCGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080531.1-359s21c1
Sequence:CCGGATGGAGTGGCACATCAAATTTCTCGAGAAATTTGATGTGCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080531.1-397s21c1
Sequence:CCGGTTTCCGACACCTCCAAATTATCTCGAGATAATTTGGAGGTGTCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080531
C4orf51 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 51
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080531.1-306s21c1
Sequence:CCGGAGGACTATTCCCTGATATAACCTCGAGGTTATATCAGGGAATAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080531.1-637s21c1
Sequence:CCGGGGCGTGGAGTTTGCTTAATAACTCGAGTTATTAAGCAAACTCCACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080531.1-557s21c1
Sequence:CCGGCTGATCGATACTCCGATTATGCTCGAGCATAATCGGAGTATCGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080531.1-359s21c1
Sequence:CCGGATGGAGTGGCACATCAAATTTCTCGAGAAATTTGATGTGCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080531.1-397s21c1
Sequence:CCGGTTTCCGACACCTCCAAATTATCTCGAGATAATTTGGAGGTGTCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080531
C4orf51 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 51
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080531.1-306s21c1
Sequence:CCGGAGGACTATTCCCTGATATAACCTCGAGGTTATATCAGGGAATAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080531.1-637s21c1
Sequence:CCGGGGCGTGGAGTTTGCTTAATAACTCGAGTTATTAAGCAAACTCCACGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080531.1-557s21c1
Sequence:CCGGCTGATCGATACTCCGATTATGCTCGAGCATAATCGGAGTATCGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080531.1-359s21c1
Sequence:CCGGATGGAGTGGCACATCAAATTTCTCGAGAAATTTGATGTGCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080531.1-397s21c1
Sequence:CCGGTTTCCGACACCTCCAAATTATCTCGAGATAATTTGGAGGTGTCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks