EMAIL THIS PAGE TO A FRIEND

C4orf6

chromosome 4 open reading frame 6

17 Gene Product Result for
Synonyms: aC1
Species: Human C4orf6(10141)
UniProtKB ID: Q99440, Q17R65
Gene ID:
Human(10141) Summary: This gene is expressed in neuroblastoma; however, the function of this gene is not yet determined. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
WH0010141M1 Monoclonal Anti-C4orf6 antibody produced in mouse clone 3F12, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005750 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005750 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005750 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037731 MISSION® esiRNA esiRNA human C4orf6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005750 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234378 predicted 621
2 SASI_Hs01_00234379 predicted 640
3 SASI_Hs01_00234380 predicted 557
4 SASI_Hs01_00234381 predicted 639
5 SASI_Hs01_00234382 predicted 551
6 SASI_Hs01_00234383 predicted 635
7 SASI_Hs01_00234385 predicted 426
8 SASI_Hs01_00234387 predicted 581
9 SASI_Hs02_00340210 predicted 608
10 SASI_Hs02_00340211 predicted 527
11 SASI_Hs01_00234384 predicted 420
12 SASI_Hs01_00234386 predicted 604
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005750
C4orf6 MISSION shRNA Bacterial Glycerol Stock
chromosome 4 open reading frame 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005750.2-389s21c1
Sequence:CCGGAGCTGGACCTTTGACCCAAACCTCGAGGTTTGGGTCAAAGGTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005750.2-304s21c1
Sequence:CCGGTGGACACTATGGACGGAAATCCTCGAGGATTTCCGTCCATAGTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005750.2-563s21c1
Sequence:CCGGGGAGAAACCAACATGACGAAACTCGAGTTTCGTCATGTTGGTTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005750.2-584s21c1
Sequence:CCGGAGACAAAGAATACTGGAGAAGCTCGAGCTTCTCCAGTATTCTTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005750.2-244s1c1
Sequence:CCGGCCTGTCAGTTGAATTTGGGAACTCGAGTTCCCAAATTCAACTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005750.2-293s1c1
Sequence:CCGGCTTCTTTCAATTGGACACTATCTCGAGATAGTGTCCAATTGAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005750.2-203s1c1
Sequence:CCGGACTCACAATTCAAAGAACCAACTCGAGTTGGTTCTTTGAATTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005750.2-324s1c1
Sequence:CCGGCCAGGAGAGCTGACCTTGGAACTCGAGTTCCAAGGTCAGCTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005750.2-435s1c1
Sequence:CCGGACTCAACTGCAGTGCATCAATCTCGAGATTGATGCACTGCAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005750
C4orf6 MISSION shRNA shRNA Plasmid DNA
chromosome 4 open reading frame 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005750.2-389s21c1
Sequence:CCGGAGCTGGACCTTTGACCCAAACCTCGAGGTTTGGGTCAAAGGTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005750.2-304s21c1
Sequence:CCGGTGGACACTATGGACGGAAATCCTCGAGGATTTCCGTCCATAGTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005750.2-563s21c1
Sequence:CCGGGGAGAAACCAACATGACGAAACTCGAGTTTCGTCATGTTGGTTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005750.2-584s21c1
Sequence:CCGGAGACAAAGAATACTGGAGAAGCTCGAGCTTCTCCAGTATTCTTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005750.2-244s1c1
Sequence:CCGGCCTGTCAGTTGAATTTGGGAACTCGAGTTCCCAAATTCAACTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005750.2-293s1c1
Sequence:CCGGCTTCTTTCAATTGGACACTATCTCGAGATAGTGTCCAATTGAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005750.2-203s1c1
Sequence:CCGGACTCACAATTCAAAGAACCAACTCGAGTTGGTTCTTTGAATTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005750.2-324s1c1
Sequence:CCGGCCAGGAGAGCTGACCTTGGAACTCGAGTTCCAAGGTCAGCTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005750.2-435s1c1
Sequence:CCGGACTCAACTGCAGTGCATCAATCTCGAGATTGATGCACTGCAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005750
C4orf6 MISSION shRNA Lentiviral Transduction Particles
chromosome 4 open reading frame 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005750.2-389s21c1
Sequence:CCGGAGCTGGACCTTTGACCCAAACCTCGAGGTTTGGGTCAAAGGTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005750.2-304s21c1
Sequence:CCGGTGGACACTATGGACGGAAATCCTCGAGGATTTCCGTCCATAGTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005750.2-563s21c1
Sequence:CCGGGGAGAAACCAACATGACGAAACTCGAGTTTCGTCATGTTGGTTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005750.2-584s21c1
Sequence:CCGGAGACAAAGAATACTGGAGAAGCTCGAGCTTCTCCAGTATTCTTTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005750.2-244s1c1
Sequence:CCGGCCTGTCAGTTGAATTTGGGAACTCGAGTTCCCAAATTCAACTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005750.2-293s1c1
Sequence:CCGGCTTCTTTCAATTGGACACTATCTCGAGATAGTGTCCAATTGAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005750.2-203s1c1
Sequence:CCGGACTCACAATTCAAAGAACCAACTCGAGTTGGTTCTTTGAATTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005750.2-324s1c1
Sequence:CCGGCCAGGAGAGCTGACCTTGGAACTCGAGTTCCAAGGTCAGCTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005750.2-435s1c1
Sequence:CCGGACTCAACTGCAGTGCATCAATCTCGAGATTGATGCACTGCAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks