EMAIL THIS PAGE TO A FRIEND

C5

complement component 5

95 Gene Product Result for
Synonyms: C5a C5b CPAMD4
UniProtKB ID: P01031, Q14CJ0, Q27I61
Gene ID:
Human(727) Summary: The protein encoded by this gene is the fifth component of complement, which plays an important role in inflammatory and cell killing processes. This protein is comprised of alpha and beta polypeptide chains that are linked by a disulfide bridge. An activation peptide, C5a, which is an anaphylatoxin that possesses potent spasmogenic and chemotactic activity, is derived from the alpha polypeptide via cleavage with a convertase. The C5b macromolecular cleavage product can form a complex with the C6 complement component, and this complex is the basis for formation of the membrane attack complex, which includes additional complement components. Mutations in this gene cause complement component 5 deficiency, a disease where patients show a propensity for severe recurrent infections. Defects in this gene have also been linked to a susceptibility to liver fibrosis and to rheumatoid arthritis. [provided by RefSeq, Jul 2008]
Rat(362119) complement component 5
Zebrafish(565774) complement component 5
cow(512045) complement component 5
domestic cat(101090401) complement component 5
dog(474816) complement component 5
chicken(417122) complement component 5
sheep(101121825) complement component 5
naked mole-rat(101710435) complement component 5
domestic guinea pig(100733000) complement component 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001735 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045151 MISSION® esiRNA esiRNA human C5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001735 Rosetta Predictions human pricing
XM_001079130 Rosetta Predictions rat pricing
XM_345342 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332446 predicted 3433
2 SASI_Hs01_00246338 predicted 2893
3 SASI_Hs01_00246339 predicted 4217
4 SASI_Hs01_00246341 predicted 4870
5 SASI_Hs02_00332447 predicted 597
6 SASI_Hs02_00332448 predicted 1076
7 SASI_Hs02_00332449 predicted 2637
8 SASI_Hs01_00246343 predicted 718
9 SASI_Hs01_00246344 predicted 1435
10 SASI_Hs02_00332450 predicted 741
11 SASI_Hs01_00246340 predicted 503
12 SASI_Hs01_00246342 predicted 3983
13 SASI_Hs01_00246345 predicted 4200
14 SASI_Hs01_00246346 predicted 3542
15 SASI_Hs01_00246347 predicted 4253
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363237 predicted 3960
2 SASI_Rn02_00363238 predicted 3348
3 SASI_Rn02_00363239 predicted 3898
4 SASI_Rn02_00363240 predicted 2260
5 SASI_Rn02_00363241 predicted 4793
6 SASI_Rn02_00363242 predicted 770
7 SASI_Rn02_00363243 predicted 524
8 SASI_Rn02_00363244 predicted 978
9 SASI_Rn02_00363245 predicted 1106
10 SASI_Rn02_00363246 predicted 2786
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398245 predicted 3926
2 SASI_Rn02_00398246 predicted 3321
3 SASI_Rn02_00398247 predicted 3863
4 SASI_Rn02_00398248 predicted 2220
5 SASI_Rn02_00398249 predicted 4752
6 SASI_Rn02_00398250 predicted 708
7 SASI_Rn02_00398251 predicted 467
8 SASI_Rn02_00398252 predicted 929
9 SASI_Rn02_00398253 predicted 1073
10 SASI_Rn02_00398254 predicted 2756
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001735
VALIDATED
C5 MISSION shRNA Bacterial Glycerol Stock
complement component 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001735.2-5077s1c1
Sequence:CCGGGCTGCATACAGTTTGCACTTACTCGAGTAAGTGCAAACTGTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001735.2-2244s1c1
Sequence:CCGGCCGTGCTAATATCTCTCATAACTCGAGTTATGAGAGATATTAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001735.2-4462s1c1
Sequence:CCGGCGGATATTTGAACTCTTTGAACTCGAGTTCAAAGAGTTCAAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001735.2-3439s1c1
Sequence:CCGGGCCCGAGAGAACAGCTTATATCTCGAGATATAAGCTGTTCTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001735.2-1081s1c1
Sequence:CCGGCCCTACAAACTGAATTTGGTTCTCGAGAACCAAATTCAGTTTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001735.2-2129s21c1
Sequence:CCGGACGATGGAGCCTGCGTTAATACTCGAGTATTAACGCAGGCTCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001735.2-1642s21c1
Sequence:CCGGTCCCGACTTCTGGTCTATTACCTCGAGGTAATAGACCAGAAGTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001735.2-5077s21c1
Sequence:CCGGGCTGCATACAGTTTGCACTTACTCGAGTAAGTGCAAACTGTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001735.2-3439s21c1
Sequence:CCGGGCCCGAGAGAACAGCTTATATCTCGAGATATAAGCTGTTCTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001735.2-3911s21c1
Sequence:CCGGTTGAGGGCCTGACGGAATATTCTCGAGAATATTCCGTCAGGCCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001735
VALIDATED
C5 MISSION shRNA shRNA Plasmid DNA
complement component 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001735.2-5077s1c1
Sequence:CCGGGCTGCATACAGTTTGCACTTACTCGAGTAAGTGCAAACTGTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001735.2-2244s1c1
Sequence:CCGGCCGTGCTAATATCTCTCATAACTCGAGTTATGAGAGATATTAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001735.2-4462s1c1
Sequence:CCGGCGGATATTTGAACTCTTTGAACTCGAGTTCAAAGAGTTCAAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001735.2-3439s1c1
Sequence:CCGGGCCCGAGAGAACAGCTTATATCTCGAGATATAAGCTGTTCTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001735.2-1081s1c1
Sequence:CCGGCCCTACAAACTGAATTTGGTTCTCGAGAACCAAATTCAGTTTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001735.2-2129s21c1
Sequence:CCGGACGATGGAGCCTGCGTTAATACTCGAGTATTAACGCAGGCTCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001735.2-1642s21c1
Sequence:CCGGTCCCGACTTCTGGTCTATTACCTCGAGGTAATAGACCAGAAGTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001735.2-5077s21c1
Sequence:CCGGGCTGCATACAGTTTGCACTTACTCGAGTAAGTGCAAACTGTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001735.2-3439s21c1
Sequence:CCGGGCCCGAGAGAACAGCTTATATCTCGAGATATAAGCTGTTCTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001735.2-3911s21c1
Sequence:CCGGTTGAGGGCCTGACGGAATATTCTCGAGAATATTCCGTCAGGCCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001735
VALIDATED
C5 MISSION shRNA Lentiviral Transduction Particles
complement component 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057198    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001735.2-5077s1c1
Sequence:CCGGGCTGCATACAGTTTGCACTTACTCGAGTAAGTGCAAACTGTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001735.2-2244s1c1
Sequence:CCGGCCGTGCTAATATCTCTCATAACTCGAGTTATGAGAGATATTAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001735.2-4462s1c1
Sequence:CCGGCGGATATTTGAACTCTTTGAACTCGAGTTCAAAGAGTTCAAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001735.2-3439s1c1
Sequence:CCGGGCCCGAGAGAACAGCTTATATCTCGAGATATAAGCTGTTCTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001735.2-1081s1c1
Sequence:CCGGCCCTACAAACTGAATTTGGTTCTCGAGAACCAAATTCAGTTTGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001735.2-2129s21c1
Sequence:CCGGACGATGGAGCCTGCGTTAATACTCGAGTATTAACGCAGGCTCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001735.2-1642s21c1
Sequence:CCGGTCCCGACTTCTGGTCTATTACCTCGAGGTAATAGACCAGAAGTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289336    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001735.2-5077s21c1
Sequence:CCGGGCTGCATACAGTTTGCACTTACTCGAGTAAGTGCAAACTGTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001735.2-3439s21c1
Sequence:CCGGGCCCGAGAGAACAGCTTATATCTCGAGATATAAGCTGTTCTCTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001735.2-3911s21c1
Sequence:CCGGTTGAGGGCCTGACGGAATATTCTCGAGAATATTCCGTCAGGCCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks